Incidental Mutation 'R4331:Nlk'
ID323593
Institutional Source Beutler Lab
Gene Symbol Nlk
Ensembl Gene ENSMUSG00000017376
Gene Namenemo like kinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4331 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78567168-78697373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78590948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 229 (I229T)
Ref Sequence ENSEMBL: ENSMUSP00000119345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000142739
AA Change: I229T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119345
Gene: ENSMUSG00000017376
AA Change: I229T

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 27 55 N/A INTRINSIC
low complexity region 97 119 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
S_TKc 138 427 3.36e-89 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation die either during late gestation or around 4-6 weeks, depending on background. Long survivors exhibit growth retardation, neurological abnormalities, and aberrant differentiation of bone marrow stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,227,679 Y301C probably damaging Het
Ahnak G A 19: 9,015,820 D4823N probably damaging Het
Angptl2 A T 2: 33,228,748 D178V probably damaging Het
Capn8 A T 1: 182,604,454 D330V probably damaging Het
Clec16a T C 16: 10,571,669 V200A probably benign Het
Fcrla C T 1: 170,921,676 R96Q possibly damaging Het
Lrpprc A G 17: 84,740,542 probably null Het
Map4k5 A T 12: 69,827,374 S425T probably benign Het
Mthfsl A G 9: 88,688,781 V195A probably damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Plxna4 G A 6: 32,150,545 Q1876* probably null Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 A G 11: 116,602,296 Y375H probably damaging Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Ssc5d G A 7: 4,942,726 G919D probably benign Het
Vmn1r60 A T 7: 5,544,365 C245* probably null Het
Vmn2r103 T A 17: 19,794,233 M429K probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Other mutations in Nlk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Nlk APN 11 78589375 missense probably damaging 1.00
IGL02186:Nlk APN 11 78586936 missense probably damaging 1.00
IGL02336:Nlk APN 11 78586937 missense probably damaging 1.00
IGL02739:Nlk APN 11 78574851 missense probably benign 0.05
IGL02953:Nlk APN 11 78626701 missense probably benign 0.02
Verne UTSW 11 78587066 nonsense probably null
R0276:Nlk UTSW 11 78571475 missense probably benign 0.01
R0324:Nlk UTSW 11 78572431 missense possibly damaging 0.71
R0636:Nlk UTSW 11 78695844 missense probably benign 0.34
R0639:Nlk UTSW 11 78572277 missense possibly damaging 0.86
R1776:Nlk UTSW 11 78587027 missense probably benign 0.03
R1886:Nlk UTSW 11 78586928 missense probably damaging 1.00
R4330:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R5974:Nlk UTSW 11 78590966 missense probably benign 0.39
R6532:Nlk UTSW 11 78696055 missense probably damaging 0.99
R6669:Nlk UTSW 11 78587066 nonsense probably null
R6873:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R7165:Nlk UTSW 11 78590967 nonsense probably null
R7475:Nlk UTSW 11 78583399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAGCATGCTCAAGGATTTG -3'
(R):5'- GCCTGTCTAGAAGCTAGCTG -3'

Sequencing Primer
(F):5'- AGTTTAATACCTAGCACTTCTAACCC -3'
(R):5'- GTCTAGAAGCTAGCTGTCTTCAAAC -3'
Posted On2015-06-24