Mutagenetix > Incidental Mutation

Incidental Mutation 'R4331:Map4k5'

323596

Institutional Source

Beutler Lab

Gene Symbol

Map4k5

Ensembl Gene

ENSMUSG00000034761

Gene Name

mitogen-activated protein kinase kinase kinase kinase 5

Synonyms

KHS, GCKR, 4432415E19Rik, MAPKKKK5

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4331 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69850531-69939937 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69874148 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 425 (S425T)

Ref Sequence

ENSEMBL: ENSMUSP00000106196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049239] [ENSMUST00000110567] [ENSMUST00000110570] [ENSMUST00000171211]

AlphaFold

Q8BPM2

Predicted Effect

probably benign
Transcript: ENSMUST00000049239
AA Change: S444T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000047812
Gene: ENSMUSG00000034761
AA Change: S444T

Domain	Start	End	E-Value	Type
S_TKc	20	277	4.07e-88	SMART
low complexity region	389	396	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
CNH	512	827	4.57e-142	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110567
AA Change: S425T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106196
Gene: ENSMUSG00000034761
AA Change: S425T

Domain	Start	End	E-Value	Type
S_TKc	20	277	4.07e-88	SMART
low complexity region	370	377	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
CNH	493	808	3.98e-142	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110570
AA Change: S444T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106199
Gene: ENSMUSG00000034761
AA Change: S444T

Domain	Start	End	E-Value	Type
S_TKc	20	277	4.07e-88	SMART
low complexity region	389	396	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
CNH	512	827	3.98e-142	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153712

Predicted Effect

probably benign
Transcript: ENSMUST00000171211
AA Change: S377T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126006
Gene: ENSMUSG00000034761
AA Change: S377T

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	208	2e-32	PFAM
Pfam:Pkinase	1	210	6.2e-52	PFAM
low complexity region	322	329	N/A	INTRINSIC
low complexity region	404	415	N/A	INTRINSIC
CNH	445	760	4.57e-142	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188608

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and phenotypically normal but show impaired canonical and noncanonical Wnt signaling in progenitor B lymphocytes. Mice homozygous for a gene trap exhibit hypoalgesia, increased serum IgG1 and an increased percentage of peripheral blood CD4+ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	T	C	15: 83,111,880 (GRCm39)	Y301C	probably damaging	Het
Ahnak	G	A	19: 8,993,184 (GRCm39)	D4823N	probably damaging	Het
Angptl2	A	T	2: 33,118,760 (GRCm39)	D178V	probably damaging	Het
Capn8	A	T	1: 182,432,019 (GRCm39)	D330V	probably damaging	Het
Clec16a	T	C	16: 10,389,533 (GRCm39)	V200A	probably benign	Het
Fcrla	C	T	1: 170,749,245 (GRCm39)	R96Q	possibly damaging	Het
Lrpprc	A	G	17: 85,047,970 (GRCm39)		probably null	Het
Mthfsl	A	G	9: 88,570,834 (GRCm39)	V195A	probably damaging	Het
Myocd	A	T	11: 65,114,590 (GRCm39)	H49Q	probably benign	Het
Nlk	A	G	11: 78,481,774 (GRCm39)	I229T	possibly damaging	Het
Plxna4	G	A	6: 32,127,480 (GRCm39)	Q1876*	probably null	Het
Ramp1	C	T	1: 91,151,067 (GRCm39)	T144I	possibly damaging	Het
Rhbdf2	A	G	11: 116,493,122 (GRCm39)	Y375H	probably damaging	Het
Scpep1	G	A	11: 88,826,729 (GRCm39)	Q236*	probably null	Het
Ssc5d	G	A	7: 4,945,725 (GRCm39)	G919D	probably benign	Het
Vmn1r60	A	T	7: 5,547,364 (GRCm39)	C245*	probably null	Het
Vmn2r103	T	A	17: 20,014,495 (GRCm39)	M429K	probably benign	Het
Zfp28	A	T	7: 6,396,700 (GRCm39)	Q378H	probably benign	Het

Other mutations in Map4k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Map4k5	APN	12	69,892,506 (GRCm39)	missense	probably damaging	1.00
IGL01013:Map4k5	APN	12	69,874,300 (GRCm39)	splice site	probably benign
IGL01309:Map4k5	APN	12	69,888,737 (GRCm39)	missense	probably benign	0.00
IGL02314:Map4k5	APN	12	69,865,213 (GRCm39)	missense	probably benign	0.05
IGL02612:Map4k5	APN	12	69,896,358 (GRCm39)	missense	possibly damaging	0.63
IGL02620:Map4k5	APN	12	69,939,476 (GRCm39)	missense	probably benign	0.05
IGL02749:Map4k5	APN	12	69,862,580 (GRCm39)	missense	probably benign	0.25
R0662:Map4k5	UTSW	12	69,859,927 (GRCm39)	missense	probably damaging	1.00
R0731:Map4k5	UTSW	12	69,921,038 (GRCm39)	intron	probably benign
R0828:Map4k5	UTSW	12	69,852,100 (GRCm39)	missense	probably damaging	0.98
R1026:Map4k5	UTSW	12	69,921,062 (GRCm39)	missense	possibly damaging	0.95
R1178:Map4k5	UTSW	12	69,863,152 (GRCm39)	missense	probably damaging	0.99
R1464:Map4k5	UTSW	12	69,852,124 (GRCm39)	missense	possibly damaging	0.89
R1464:Map4k5	UTSW	12	69,852,124 (GRCm39)	missense	possibly damaging	0.89
R1615:Map4k5	UTSW	12	69,891,187 (GRCm39)	missense	probably damaging	1.00
R1632:Map4k5	UTSW	12	69,874,821 (GRCm39)	missense	probably benign
R1652:Map4k5	UTSW	12	69,877,201 (GRCm39)	critical splice donor site	probably null
R1677:Map4k5	UTSW	12	69,852,082 (GRCm39)	missense	probably benign	0.01
R1835:Map4k5	UTSW	12	69,871,436 (GRCm39)	missense	probably damaging	1.00
R1895:Map4k5	UTSW	12	69,892,529 (GRCm39)	missense	probably damaging	1.00
R1946:Map4k5	UTSW	12	69,892,529 (GRCm39)	missense	probably damaging	1.00
R1968:Map4k5	UTSW	12	69,865,266 (GRCm39)	missense	probably damaging	0.99
R1971:Map4k5	UTSW	12	69,873,102 (GRCm39)	missense	possibly damaging	0.81
R1987:Map4k5	UTSW	12	69,889,686 (GRCm39)	missense	probably damaging	1.00
R2070:Map4k5	UTSW	12	69,863,111 (GRCm39)	missense	probably damaging	0.99
R2471:Map4k5	UTSW	12	69,903,620 (GRCm39)	missense	probably benign	0.30
R3417:Map4k5	UTSW	12	69,856,038 (GRCm39)	missense	probably damaging	1.00
R4133:Map4k5	UTSW	12	69,892,497 (GRCm39)	missense	probably damaging	1.00
R4388:Map4k5	UTSW	12	69,892,583 (GRCm39)	missense	probably damaging	1.00
R4685:Map4k5	UTSW	12	69,858,140 (GRCm39)	missense	probably benign
R4760:Map4k5	UTSW	12	69,871,372 (GRCm39)	missense	possibly damaging	0.49
R4822:Map4k5	UTSW	12	69,888,758 (GRCm39)	nonsense	probably null
R4863:Map4k5	UTSW	12	69,865,212 (GRCm39)	missense	probably benign	0.04
R4971:Map4k5	UTSW	12	69,899,493 (GRCm39)	missense	possibly damaging	0.60
R5038:Map4k5	UTSW	12	69,871,388 (GRCm39)	missense	probably damaging	1.00
R5055:Map4k5	UTSW	12	69,878,332 (GRCm39)	missense	probably benign
R5248:Map4k5	UTSW	12	69,888,755 (GRCm39)	missense	probably benign	0.36
R5428:Map4k5	UTSW	12	69,884,787 (GRCm39)	missense	possibly damaging	0.94
R5697:Map4k5	UTSW	12	69,877,210 (GRCm39)	missense	probably benign
R5757:Map4k5	UTSW	12	69,871,429 (GRCm39)	missense	probably damaging	1.00
R5955:Map4k5	UTSW	12	69,891,164 (GRCm39)	missense	probably damaging	1.00
R6258:Map4k5	UTSW	12	69,878,336 (GRCm39)	missense	probably benign	0.06
R6259:Map4k5	UTSW	12	69,899,514 (GRCm39)	missense	probably damaging	0.97
R6260:Map4k5	UTSW	12	69,878,336 (GRCm39)	missense	probably benign	0.06
R6796:Map4k5	UTSW	12	69,864,799 (GRCm39)	missense	probably benign	0.01
R6979:Map4k5	UTSW	12	69,869,622 (GRCm39)	missense	probably damaging	1.00
R7164:Map4k5	UTSW	12	69,877,210 (GRCm39)	missense	probably benign
R7184:Map4k5	UTSW	12	69,921,095 (GRCm39)	missense	probably benign	0.00
R7598:Map4k5	UTSW	12	69,871,412 (GRCm39)	missense	possibly damaging	0.75
R8395:Map4k5	UTSW	12	69,877,203 (GRCm39)	missense	probably null
R8445:Map4k5	UTSW	12	69,897,741 (GRCm39)	missense	probably damaging	1.00
R8757:Map4k5	UTSW	12	69,897,598 (GRCm39)	critical splice donor site	probably benign
R8827:Map4k5	UTSW	12	69,903,635 (GRCm39)	missense	possibly damaging	0.88
R8896:Map4k5	UTSW	12	69,870,275 (GRCm39)	missense	possibly damaging	0.94
R8898:Map4k5	UTSW	12	69,859,931 (GRCm39)	missense	possibly damaging	0.88
R9224:Map4k5	UTSW	12	69,939,467 (GRCm39)	missense	possibly damaging	0.61
R9563:Map4k5	UTSW	12	69,863,167 (GRCm39)	missense	probably benign	0.40
RF002:Map4k5	UTSW	12	69,903,630 (GRCm39)	missense	probably damaging	0.96
X0062:Map4k5	UTSW	12	69,871,381 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAATCTTTTACAGTCCACTTGTGC -3'
(R):5'- TTGCTGAAGGTCACTGTGAC -3'

Sequencing Primer
(F):5'- CAGTCCACTTGTGCATAATTAAAAC -3'
(R):5'- GTCACTGTGACCTTTTAAAGAGCAC -3'

Posted On

2015-06-24