Mutagenetix > Incidental Mutation

Incidental Mutation 'R4331:Vmn2r103'

323598

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r103

Ensembl Gene

ENSMUSG00000091771

Gene Name

vomeronasal 2, receptor 103

Synonyms

EG627636

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R4331 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19773363-19812536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19794233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 429 (M429K)

Ref Sequence

ENSEMBL: ENSMUSP00000126756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172203]

AlphaFold

E9PWW0

Predicted Effect

probably benign
Transcript: ENSMUST00000172203
AA Change: M429K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: M429K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	449	1.3e-37	PFAM
Pfam:NCD3G	509	562	3.5e-22	PFAM
Pfam:7tm_3	595	830	1.1e-51	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	T	C	15: 83,227,679	Y301C	probably damaging	Het
Ahnak	G	A	19: 9,015,820	D4823N	probably damaging	Het
Angptl2	A	T	2: 33,228,748	D178V	probably damaging	Het
Capn8	A	T	1: 182,604,454	D330V	probably damaging	Het
Clec16a	T	C	16: 10,571,669	V200A	probably benign	Het
Fcrla	C	T	1: 170,921,676	R96Q	possibly damaging	Het
Lrpprc	A	G	17: 84,740,542		probably null	Het
Map4k5	A	T	12: 69,827,374	S425T	probably benign	Het
Mthfsl	A	G	9: 88,688,781	V195A	probably damaging	Het
Myocd	A	T	11: 65,223,764	H49Q	probably benign	Het
Nlk	A	G	11: 78,590,948	I229T	possibly damaging	Het
Plxna4	G	A	6: 32,150,545	Q1876*	probably null	Het
Ramp1	C	T	1: 91,223,345	T144I	possibly damaging	Het
Rhbdf2	A	G	11: 116,602,296	Y375H	probably damaging	Het
Scpep1	G	A	11: 88,935,903	Q236*	probably null	Het
Ssc5d	G	A	7: 4,942,726	G919D	probably benign	Het
Vmn1r60	A	T	7: 5,544,365	C245*	probably null	Het
Zfp28	A	T	7: 6,393,701	Q378H	probably benign	Het

Other mutations in Vmn2r103

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Vmn2r103	APN	17	19793102	missense	probably damaging	0.98
IGL00939:Vmn2r103	APN	17	19794965	missense	probably benign	0.00
IGL01120:Vmn2r103	APN	17	19792997	missense	probably benign	0.06
IGL01403:Vmn2r103	APN	17	19792967	missense	probably benign
IGL01404:Vmn2r103	APN	17	19812434	missense	probably damaging	1.00
IGL01713:Vmn2r103	APN	17	19794068	missense	probably damaging	1.00
IGL01802:Vmn2r103	APN	17	19799208	missense	probably benign
IGL02251:Vmn2r103	APN	17	19793969	missense	possibly damaging	0.84
IGL02466:Vmn2r103	APN	17	19773369	missense	probably benign
IGL02555:Vmn2r103	APN	17	19811611	missense	probably damaging	1.00
IGL02668:Vmn2r103	APN	17	19794127	missense	probably benign	0.03
IGL02715:Vmn2r103	APN	17	19793956	missense	probably damaging	0.97
IGL02735:Vmn2r103	APN	17	19812248	missense	probably benign	0.27
IGL03101:Vmn2r103	APN	17	19773520	missense	probably damaging	0.98
R0003:Vmn2r103	UTSW	17	19811979	missense	probably damaging	0.99
R0052:Vmn2r103	UTSW	17	19811641	missense	probably benign	0.01
R0375:Vmn2r103	UTSW	17	19792859	missense	probably benign	0.06
R0375:Vmn2r103	UTSW	17	19793464	missense	probably benign	0.12
R0755:Vmn2r103	UTSW	17	19773568	missense	probably benign	0.01
R0837:Vmn2r103	UTSW	17	19793927	missense	probably damaging	0.99
R1345:Vmn2r103	UTSW	17	19794247	missense	probably damaging	1.00
R1396:Vmn2r103	UTSW	17	19792968	missense	probably benign
R1488:Vmn2r103	UTSW	17	19793660	missense	probably damaging	0.97
R1533:Vmn2r103	UTSW	17	19773400	missense	probably benign	0.01
R1590:Vmn2r103	UTSW	17	19794234	missense	probably benign
R1928:Vmn2r103	UTSW	17	19811767	missense	possibly damaging	0.95
R1942:Vmn2r103	UTSW	17	19812300	missense	probably benign	0.02
R2071:Vmn2r103	UTSW	17	19793794	missense	probably benign
R2219:Vmn2r103	UTSW	17	19793647	missense	probably damaging	1.00
R2442:Vmn2r103	UTSW	17	19773531	missense	probably benign	0.00
R2889:Vmn2r103	UTSW	17	19793600	missense	probably damaging	1.00
R3762:Vmn2r103	UTSW	17	19812149	missense	probably damaging	0.98
R4014:Vmn2r103	UTSW	17	19793604	missense	possibly damaging	0.67
R4630:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4631:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4632:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4660:Vmn2r103	UTSW	17	19811815	missense	probably damaging	1.00
R4801:Vmn2r103	UTSW	17	19795076	missense	probably benign	0.06
R4802:Vmn2r103	UTSW	17	19795076	missense	probably benign	0.06
R4931:Vmn2r103	UTSW	17	19811769	missense	probably benign	0.01
R4995:Vmn2r103	UTSW	17	19773511	missense	probably benign	0.14
R5309:Vmn2r103	UTSW	17	19793034	missense	probably benign	0.01
R5312:Vmn2r103	UTSW	17	19793034	missense	probably benign	0.01
R5329:Vmn2r103	UTSW	17	19812171	missense	probably damaging	1.00
R5611:Vmn2r103	UTSW	17	19793642	missense	probably damaging	0.99
R5684:Vmn2r103	UTSW	17	19792989	missense	probably benign	0.02
R5715:Vmn2r103	UTSW	17	19794939	missense	probably benign	0.17
R5907:Vmn2r103	UTSW	17	19812453	missense	possibly damaging	0.67
R6029:Vmn2r103	UTSW	17	19794216	nonsense	probably null
R6114:Vmn2r103	UTSW	17	19812325	missense	probably damaging	0.99
R6285:Vmn2r103	UTSW	17	19812144	missense	probably benign
R6292:Vmn2r103	UTSW	17	19793604	missense	possibly damaging	0.67
R6334:Vmn2r103	UTSW	17	19794082	missense	probably damaging	0.97
R6501:Vmn2r103	UTSW	17	19811904	missense	probably benign	0.29
R6710:Vmn2r103	UTSW	17	19811977	missense	probably damaging	1.00
R6774:Vmn2r103	UTSW	17	19773511	missense	probably benign	0.14
R6981:Vmn2r103	UTSW	17	19793477	missense	probably benign	0.00
R7768:Vmn2r103	UTSW	17	19812052	missense	probably damaging	0.99
R7816:Vmn2r103	UTSW	17	19794214	missense	probably benign	0.06
R7885:Vmn2r103	UTSW	17	19793123	missense	probably benign	0.25
R8002:Vmn2r103	UTSW	17	19799249	missense	probably damaging	1.00
R8031:Vmn2r103	UTSW	17	19793497	missense	probably benign	0.00
R8140:Vmn2r103	UTSW	17	19811796	missense	probably damaging	1.00
R8186:Vmn2r103	UTSW	17	19811943	missense	probably damaging	1.00
R8559:Vmn2r103	UTSW	17	19812384	missense	probably benign	0.01
R9413:Vmn2r103	UTSW	17	19811896	missense	possibly damaging	0.54
R9591:Vmn2r103	UTSW	17	19811659	missense	possibly damaging	0.70
R9652:Vmn2r103	UTSW	17	19793765	missense	probably benign	0.01
R9680:Vmn2r103	UTSW	17	19799263	nonsense	probably null
R9743:Vmn2r103	UTSW	17	19812213	missense	probably damaging	1.00
Z1088:Vmn2r103	UTSW	17	19795047	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TTCAAGTGCTCATTTGCTGAC -3'
(R):5'- CCTGGTATGTTACACACGATTTCAG -3'

Sequencing Primer
(F):5'- GTGCTCATTTGCTGACATTAATTG -3'
(R):5'- CACGATTTCAGAACATCATTCACTGG -3'

Posted On

2015-06-24