Incidental Mutation 'R4332:P2rx3'
ID 323608
Institutional Source Beutler Lab
Gene Symbol P2rx3
Ensembl Gene ENSMUSG00000027071
Gene Name purinergic receptor P2X, ligand-gated ion channel, 3
Synonyms P2X3, 4930513E20Rik
MMRRC Submission 041099-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R4332 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 84828927-84867806 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84855205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 84 (P84S)
Ref Sequence ENSEMBL: ENSMUSP00000107240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000111613] [ENSMUST00000111616]
AlphaFold Q3UR32
Predicted Effect probably benign
Transcript: ENSMUST00000028465
AA Change: P84S

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071
AA Change: P84S

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 367 1.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111613
AA Change: P84S

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071
AA Change: P84S

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111616
AA Change: P84S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071
AA Change: P84S

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 91 1.2e-32 PFAM
Pfam:P2X_receptor 86 350 3.3e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145285
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show normal ventilatory responses to hypoxia. Mice homozygous for a reporter allele show loss of rapidly desensitizing ATP-gated cation currents in dorsal root ganglion neurons, reduced formalin-evoked pain behavior, and enhanced thermal hyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 106,436,356 (GRCm39) I175T possibly damaging Het
A2m A G 6: 121,634,406 (GRCm39) D646G probably benign Het
Acat2 T C 17: 13,181,782 (GRCm39) probably benign Het
Armc10 T A 5: 21,866,579 (GRCm39) V281E probably damaging Het
Best3 T A 10: 116,838,429 (GRCm39) F162L probably benign Het
Ces1g T C 8: 94,046,446 (GRCm39) M360V probably benign Het
Chd7 G T 4: 8,854,143 (GRCm39) R1905L probably damaging Het
Dhx36 C T 3: 62,392,412 (GRCm39) R538Q probably damaging Het
Efna2 G A 10: 80,024,315 (GRCm39) R161Q probably damaging Het
Farsb T C 1: 78,445,903 (GRCm39) T159A possibly damaging Het
Fry C T 5: 150,305,128 (GRCm39) A611V probably damaging Het
Fsip2 A G 2: 82,808,201 (GRCm39) T1507A probably benign Het
Gm5592 G T 7: 40,865,542 (GRCm39) probably benign Het
Gm7367 T C 7: 59,805,364 (GRCm39) noncoding transcript Het
Gm9312 A T 12: 24,302,095 (GRCm39) noncoding transcript Het
Gmfg A T 7: 28,136,997 (GRCm39) M1L probably benign Het
Gpr149 C A 3: 62,511,794 (GRCm39) L68F possibly damaging Het
Hmga2 T C 10: 120,200,117 (GRCm39) probably benign Het
Il12a C A 3: 68,602,594 (GRCm39) probably benign Het
Itprid1 G A 6: 55,945,220 (GRCm39) G647D possibly damaging Het
Itsn2 T A 12: 4,762,611 (GRCm39) M1597K possibly damaging Het
Kyat3 A G 3: 142,431,187 (GRCm39) I154M probably damaging Het
Npas3 A C 12: 54,108,852 (GRCm39) I419L probably damaging Het
Ogfrl1 T A 1: 23,414,910 (GRCm39) Y199F probably damaging Het
Or14a259 A C 7: 86,013,080 (GRCm39) V155G probably benign Het
Or5aq7 A G 2: 86,938,089 (GRCm39) V214A possibly damaging Het
Or6b6 T C 7: 106,571,354 (GRCm39) M66V probably benign Het
P3h3 A G 6: 124,819,099 (GRCm39) V657A probably damaging Het
Pabpc2 A G 18: 39,908,393 (GRCm39) M553V probably benign Het
Pcdhb1 T C 18: 37,398,583 (GRCm39) F178S probably damaging Het
Plppr4 A T 3: 117,116,474 (GRCm39) M403K probably benign Het
Ralgapa2 G A 2: 146,102,288 (GRCm39) T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 (GRCm39) K542N probably benign Het
Rdh8 C T 9: 20,733,925 (GRCm39) A37V probably damaging Het
Rnf213 A G 11: 119,327,502 (GRCm39) T1830A probably damaging Het
Sardh G T 2: 27,105,126 (GRCm39) Q666K possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Septin4 T G 11: 87,458,730 (GRCm39) L368R possibly damaging Het
Serpinb11 G A 1: 107,297,294 (GRCm39) probably null Het
Slc6a6 G A 6: 91,700,452 (GRCm39) G60D probably damaging Het
Tfr2 A G 5: 137,569,996 (GRCm39) D134G probably damaging Het
Tmprss15 T C 16: 78,831,222 (GRCm39) T378A probably benign Het
Tmprss7 T G 16: 45,506,690 (GRCm39) K124T probably benign Het
Urb1 A G 16: 90,571,425 (GRCm39) L1128P probably damaging Het
Usp32 C T 11: 84,994,804 (GRCm39) C36Y possibly damaging Het
Vmn2r50 T A 7: 9,786,922 (GRCm39) T62S probably benign Het
Zfp110 T A 7: 12,578,498 (GRCm39) Y136* probably null Het
Other mutations in P2rx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:P2rx3 APN 2 84,865,616 (GRCm39) missense probably damaging 1.00
IGL01775:P2rx3 APN 2 84,854,501 (GRCm39) missense probably benign
IGL01897:P2rx3 APN 2 84,853,825 (GRCm39) critical splice donor site probably benign
IGL02399:P2rx3 APN 2 84,853,571 (GRCm39) missense probably benign
R0928:P2rx3 UTSW 2 84,865,642 (GRCm39) start codon destroyed probably null 0.98
R1428:P2rx3 UTSW 2 84,855,294 (GRCm39) missense possibly damaging 0.91
R1537:P2rx3 UTSW 2 84,853,825 (GRCm39) critical splice donor site probably null
R1678:P2rx3 UTSW 2 84,852,811 (GRCm39) missense possibly damaging 0.90
R4897:P2rx3 UTSW 2 84,855,270 (GRCm39) missense probably damaging 1.00
R5052:P2rx3 UTSW 2 84,829,368 (GRCm39) missense probably benign 0.01
R5903:P2rx3 UTSW 2 84,831,071 (GRCm39) missense possibly damaging 0.93
R5917:P2rx3 UTSW 2 84,865,591 (GRCm39) missense probably damaging 1.00
R6614:P2rx3 UTSW 2 84,865,543 (GRCm39) missense probably damaging 1.00
R8250:P2rx3 UTSW 2 84,852,735 (GRCm39) missense probably damaging 1.00
R8512:P2rx3 UTSW 2 84,854,755 (GRCm39) missense probably damaging 0.98
R8953:P2rx3 UTSW 2 84,853,842 (GRCm39) missense possibly damaging 0.61
R9237:P2rx3 UTSW 2 84,853,896 (GRCm39) missense probably benign 0.02
Z1177:P2rx3 UTSW 2 84,852,820 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTGGTCACCATTAAAACACAGGC -3'
(R):5'- AGGAGAGTTATCCCATGCCC -3'

Sequencing Primer
(F):5'- CACAGGCAGGACAGGGTC -3'
(R):5'- CTGTCTCGTGAGCCTGTGAAC -3'
Posted On 2015-06-24