Incidental Mutation 'R4332:Olfr259'
ID323609
Institutional Source Beutler Lab
Gene Symbol Olfr259
Ensembl Gene ENSMUSG00000075160
Gene Nameolfactory receptor 259
SynonymsGA_x6K02T2N869-1820-882, MOR172-3
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4332 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87104578-87114567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87107745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000151207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099862] [ENSMUST00000213978] [ENSMUST00000215828] [ENSMUST00000216088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099862
AA Change: V214A

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097448
Gene: ENSMUSG00000075160
AA Change: V214A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-53 PFAM
Pfam:7tm_1 41 290 5.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213978
AA Change: V214A

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215828
AA Change: V214A

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216088
AA Change: V214A

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Olfr259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Olfr259 APN 2 87107441 utr 3 prime probably benign
IGL02540:Olfr259 APN 2 87108042 missense probably damaging 1.00
IGL02572:Olfr259 APN 2 87108366 missense possibly damaging 0.63
R2091:Olfr259 UTSW 2 87108262 missense probably damaging 1.00
R2928:Olfr259 UTSW 2 87107763 missense possibly damaging 0.88
R4107:Olfr259 UTSW 2 87107655 missense probably damaging 1.00
R4929:Olfr259 UTSW 2 87108183 missense possibly damaging 0.79
R5027:Olfr259 UTSW 2 87107806 missense probably benign 0.40
R6005:Olfr259 UTSW 2 87108063 missense probably benign 0.00
R6191:Olfr259 UTSW 2 87107952 missense probably damaging 1.00
R6358:Olfr259 UTSW 2 87108434 start gained probably benign
R6399:Olfr259 UTSW 2 87107986 missense probably benign 0.21
R6554:Olfr259 UTSW 2 87107626 missense probably benign 0.34
R7836:Olfr259 UTSW 2 87107517 missense probably damaging 1.00
R7881:Olfr259 UTSW 2 87108057 missense probably damaging 0.99
R7919:Olfr259 UTSW 2 87107517 missense probably damaging 1.00
R7964:Olfr259 UTSW 2 87108057 missense probably damaging 0.99
R8069:Olfr259 UTSW 2 87108067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCTTTTCCTGTTCCATGG -3'
(R):5'- GCACTCAAATGGTACTTGCAAG -3'

Sequencing Primer
(F):5'- CCTGTTCCATGGAGTATTGAGAAC -3'
(R):5'- GGGTGGCCTCATAAATTCCATGATTC -3'
Posted On2015-06-24