Mutagenetix > Incidental Mutation

Incidental Mutation 'R4332:Il12a'

323614

Institutional Source

Beutler Lab

Gene Symbol

Il12a

Ensembl Gene

ENSMUSG00000027776

Gene Name

interleukin 12a

Synonyms

p35, IL-12p35

MMRRC Submission

041099-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68597977-68605880 bp(+) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 68602594 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103446 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]

AlphaFold

P43431

Predicted Effect

probably benign
Transcript: ENSMUST00000029345

SMART Domains

Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
Pfam:IL12	27	236	2.5e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107816

SMART Domains

Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776

Domain	Start	End	E-Value	Type
Pfam:IL12	1	215	6.8e-128	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195517

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	C	8: 106,436,356 (GRCm39)	I175T	possibly damaging	Het
A2m	A	G	6: 121,634,406 (GRCm39)	D646G	probably benign	Het
Acat2	T	C	17: 13,181,782 (GRCm39)		probably benign	Het
Armc10	T	A	5: 21,866,579 (GRCm39)	V281E	probably damaging	Het
Best3	T	A	10: 116,838,429 (GRCm39)	F162L	probably benign	Het
Ces1g	T	C	8: 94,046,446 (GRCm39)	M360V	probably benign	Het
Chd7	G	T	4: 8,854,143 (GRCm39)	R1905L	probably damaging	Het
Dhx36	C	T	3: 62,392,412 (GRCm39)	R538Q	probably damaging	Het
Efna2	G	A	10: 80,024,315 (GRCm39)	R161Q	probably damaging	Het
Farsb	T	C	1: 78,445,903 (GRCm39)	T159A	possibly damaging	Het
Fry	C	T	5: 150,305,128 (GRCm39)	A611V	probably damaging	Het
Fsip2	A	G	2: 82,808,201 (GRCm39)	T1507A	probably benign	Het
Gm5592	G	T	7: 40,865,542 (GRCm39)		probably benign	Het
Gm7367	T	C	7: 59,805,364 (GRCm39)		noncoding transcript	Het
Gm9312	A	T	12: 24,302,095 (GRCm39)		noncoding transcript	Het
Gmfg	A	T	7: 28,136,997 (GRCm39)	M1L	probably benign	Het
Gpr149	C	A	3: 62,511,794 (GRCm39)	L68F	possibly damaging	Het
Hmga2	T	C	10: 120,200,117 (GRCm39)		probably benign	Het
Itprid1	G	A	6: 55,945,220 (GRCm39)	G647D	possibly damaging	Het
Itsn2	T	A	12: 4,762,611 (GRCm39)	M1597K	possibly damaging	Het
Kyat3	A	G	3: 142,431,187 (GRCm39)	I154M	probably damaging	Het
Npas3	A	C	12: 54,108,852 (GRCm39)	I419L	probably damaging	Het
Ogfrl1	T	A	1: 23,414,910 (GRCm39)	Y199F	probably damaging	Het
Or14a259	A	C	7: 86,013,080 (GRCm39)	V155G	probably benign	Het
Or5aq7	A	G	2: 86,938,089 (GRCm39)	V214A	possibly damaging	Het
Or6b6	T	C	7: 106,571,354 (GRCm39)	M66V	probably benign	Het
P2rx3	G	A	2: 84,855,205 (GRCm39)	P84S	probably benign	Het
P3h3	A	G	6: 124,819,099 (GRCm39)	V657A	probably damaging	Het
Pabpc2	A	G	18: 39,908,393 (GRCm39)	M553V	probably benign	Het
Pcdhb1	T	C	18: 37,398,583 (GRCm39)	F178S	probably damaging	Het
Plppr4	A	T	3: 117,116,474 (GRCm39)	M403K	probably benign	Het
Ralgapa2	G	A	2: 146,102,288 (GRCm39)	T1956M	probably benign	Het
Rbm12b1	G	T	4: 12,145,655 (GRCm39)	K542N	probably benign	Het
Rdh8	C	T	9: 20,733,925 (GRCm39)	A37V	probably damaging	Het
Rnf213	A	G	11: 119,327,502 (GRCm39)	T1830A	probably damaging	Het
Sardh	G	T	2: 27,105,126 (GRCm39)	Q666K	possibly damaging	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Septin4	T	G	11: 87,458,730 (GRCm39)	L368R	possibly damaging	Het
Serpinb11	G	A	1: 107,297,294 (GRCm39)		probably null	Het
Slc6a6	G	A	6: 91,700,452 (GRCm39)	G60D	probably damaging	Het
Tfr2	A	G	5: 137,569,996 (GRCm39)	D134G	probably damaging	Het
Tmprss15	T	C	16: 78,831,222 (GRCm39)	T378A	probably benign	Het
Tmprss7	T	G	16: 45,506,690 (GRCm39)	K124T	probably benign	Het
Urb1	A	G	16: 90,571,425 (GRCm39)	L1128P	probably damaging	Het
Usp32	C	T	11: 84,994,804 (GRCm39)	C36Y	possibly damaging	Het
Vmn2r50	T	A	7: 9,786,922 (GRCm39)	T62S	probably benign	Het
Zfp110	T	A	7: 12,578,498 (GRCm39)	Y136*	probably null	Het

Other mutations in Il12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01734:Il12a	APN	3	68,598,888 (GRCm39)	missense	possibly damaging	0.96
IGL01820:Il12a	APN	3	68,599,495 (GRCm39)	splice site	probably benign
IGL01989:Il12a	APN	3	68,598,909 (GRCm39)	splice site	probably benign
bakers_dozen	UTSW	3	68,605,320 (GRCm39)	frame shift	probably null
R0388:Il12a	UTSW	3	68,602,520 (GRCm39)	splice site	probably null
R0646:Il12a	UTSW	3	68,605,223 (GRCm39)	splice site	probably benign
R1083:Il12a	UTSW	3	68,602,666 (GRCm39)	missense	probably damaging	1.00
R1588:Il12a	UTSW	3	68,602,896 (GRCm39)	missense	probably benign	0.04
R2240:Il12a	UTSW	3	68,601,517 (GRCm39)	nonsense	probably null
R2909:Il12a	UTSW	3	68,605,320 (GRCm39)	frame shift	probably null
R2925:Il12a	UTSW	3	68,605,320 (GRCm39)	frame shift	probably null
R3696:Il12a	UTSW	3	68,605,320 (GRCm39)	frame shift	probably null
R3697:Il12a	UTSW	3	68,605,320 (GRCm39)	frame shift	probably null
R3698:Il12a	UTSW	3	68,605,320 (GRCm39)	frame shift	probably null
R5809:Il12a	UTSW	3	68,602,595 (GRCm39)	intron	probably benign
R6279:Il12a	UTSW	3	68,605,312 (GRCm39)	missense	probably damaging	0.96
R6305:Il12a	UTSW	3	68,601,511 (GRCm39)	missense	possibly damaging	0.80
R6847:Il12a	UTSW	3	68,602,899 (GRCm39)	missense	probably damaging	1.00
R7751:Il12a	UTSW	3	68,605,235 (GRCm39)	missense	probably damaging	1.00
R8188:Il12a	UTSW	3	68,598,872 (GRCm39)	missense	unknown
R8339:Il12a	UTSW	3	68,599,438 (GRCm39)	nonsense	probably null
R9145:Il12a	UTSW	3	68,598,875 (GRCm39)	missense	unknown
RF003:Il12a	UTSW	3	68,602,562 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCAAAAGCAGTTATGATGGTG -3'
(R):5'- GTCTAGAGCGCAGGACACAATG -3'

Sequencing Primer
(F):5'- TCTCAGCACTTGATAGGCAG -3'
(R):5'- CACAATGGGCAAGGAATCATTG -3'

Posted On

2015-06-24