Incidental Mutation 'R4332:Olfr711'
ID 323634
Institutional Source Beutler Lab
Gene Symbol Olfr711
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor 711
Synonyms GA_x6K02T2PBJ9-9352783-9351839, MOR103-4
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4332 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 106969694-106975453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106972147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 66 (M66V)
Ref Sequence ENSEMBL: ENSMUSP00000149016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably benign
Transcript: ENSMUST00000051715
AA Change: M66V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: M66V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207200
AA Change: M66V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216335
AA Change: M66V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1791 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Olfr711
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Olfr711 APN 7 106971549 missense possibly damaging 0.51
R0087:Olfr711 UTSW 7 106972116 missense probably benign 0.01
R0580:Olfr711 UTSW 7 106972240 missense probably damaging 1.00
R1375:Olfr711 UTSW 7 106972098 missense probably damaging 1.00
R1538:Olfr711 UTSW 7 106971983 nonsense probably null
R1875:Olfr711 UTSW 7 106972182 missense possibly damaging 0.86
R2156:Olfr711 UTSW 7 106971568 missense probably damaging 1.00
R4290:Olfr711 UTSW 7 106971711 missense probably damaging 0.97
R4400:Olfr711 UTSW 7 106972002 missense probably damaging 1.00
R4688:Olfr711 UTSW 7 106971861 missense probably benign 0.02
R4868:Olfr711 UTSW 7 106971767 missense probably benign
R4970:Olfr711 UTSW 7 106971571 missense probably benign 0.35
R5006:Olfr711 UTSW 7 106971601 missense probably damaging 1.00
R5082:Olfr711 UTSW 7 106971664 missense probably benign 0.00
R5121:Olfr711 UTSW 7 106972231 missense probably benign
R6465:Olfr711 UTSW 7 106972212 missense possibly damaging 0.63
R6541:Olfr711 UTSW 7 106972203 missense probably benign 0.20
R7419:Olfr711 UTSW 7 106972146 missense probably benign 0.01
R8048:Olfr711 UTSW 7 106972464 start gained probably benign
R9310:Olfr711 UTSW 7 106971471 missense probably damaging 1.00
R9470:Olfr711 UTSW 7 106972254 missense probably benign 0.26
R9603:Olfr711 UTSW 7 106971896 nonsense probably null
Z1177:Olfr711 UTSW 7 106971915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGCCACATAGCGGTCATAG -3'
(R):5'- AATATCTCCCAGTGCCTTTGG -3'

Sequencing Primer
(F):5'- CATAGCGGTCATAGGCCATAGCTG -3'
(R):5'- GCTGGATATGAACATTACTCTGGTC -3'
Posted On 2015-06-24