Incidental Mutation 'R4332:Gm11492'
ID 323641
Institutional Source Beutler Lab
Gene Symbol Gm11492
Ensembl Gene ENSMUSG00000090107
Gene Name predicted gene 11492
Synonyms
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R4332 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 87566653-87569250 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 87567904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 368 (L368R)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000060360
AA Change: L368R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: L368R

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Gm11492
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gm11492 APN 11 87568249 missense probably benign 0.07
IGL01993:Gm11492 APN 11 87567729 missense possibly damaging 0.85
IGL02566:Gm11492 APN 11 87567642 missense probably benign 0.00
IGL03213:Gm11492 APN 11 87567358 splice site probably null
IGL03388:Gm11492 APN 11 87568216 nonsense probably null
R0050:Gm11492 UTSW 11 87567346 missense probably damaging 1.00
R1479:Gm11492 UTSW 11 87567418 missense probably damaging 1.00
R1851:Gm11492 UTSW 11 87568915 missense probably damaging 1.00
R1862:Gm11492 UTSW 11 87567235 missense possibly damaging 0.48
R1913:Gm11492 UTSW 11 87567012 missense probably benign
R3149:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3176:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3276:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R4021:Gm11492 UTSW 11 87567280 missense probably damaging 1.00
R4117:Gm11492 UTSW 11 87568282 missense probably damaging 1.00
R4515:Gm11492 UTSW 11 87568057 missense probably benign
R4663:Gm11492 UTSW 11 87567603 missense probably damaging 0.98
R4952:Gm11492 UTSW 11 87567772 missense probably benign 0.00
R5015:Gm11492 UTSW 11 87567217 missense possibly damaging 0.95
R5176:Gm11492 UTSW 11 87567532 missense probably benign 0.02
R5711:Gm11492 UTSW 11 87567897 missense probably benign 0.07
R6305:Gm11492 UTSW 11 87567319 missense probably benign 0.00
R9289:Gm11492 UTSW 11 87568966 nonsense probably null
T0970:Gm11492 UTSW 11 87567732 missense probably damaging 0.98
Z1177:Gm11492 UTSW 11 87567922 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATTGGGACCAAGCCCTC -3'
(R):5'- CTCACAGAAAGGGGTTGAGTC -3'

Sequencing Primer
(F):5'- TCCCCAAAGATTTTAATATCCGAAGC -3'
(R):5'- AGGCGACTTAGGTTCAAGATC -3'
Posted On 2015-06-24