Incidental Mutation 'R4332:Septin4'
ID 323641
Institutional Source Beutler Lab
Gene Symbol Septin4
Ensembl Gene ENSMUSG00000020486
Gene Name septin 4
Synonyms Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2
MMRRC Submission 041099-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.796) question?
Stock # R4332 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 87457515-87481365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 87458730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 368 (L368R)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
AlphaFold P28661
Q5ND19
Predicted Effect possibly damaging
Transcript: ENSMUST00000060360
AA Change: L368R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: L368R

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 106,436,356 (GRCm39) I175T possibly damaging Het
A2m A G 6: 121,634,406 (GRCm39) D646G probably benign Het
Acat2 T C 17: 13,181,782 (GRCm39) probably benign Het
Armc10 T A 5: 21,866,579 (GRCm39) V281E probably damaging Het
Best3 T A 10: 116,838,429 (GRCm39) F162L probably benign Het
Ces1g T C 8: 94,046,446 (GRCm39) M360V probably benign Het
Chd7 G T 4: 8,854,143 (GRCm39) R1905L probably damaging Het
Dhx36 C T 3: 62,392,412 (GRCm39) R538Q probably damaging Het
Efna2 G A 10: 80,024,315 (GRCm39) R161Q probably damaging Het
Farsb T C 1: 78,445,903 (GRCm39) T159A possibly damaging Het
Fry C T 5: 150,305,128 (GRCm39) A611V probably damaging Het
Fsip2 A G 2: 82,808,201 (GRCm39) T1507A probably benign Het
Gm5592 G T 7: 40,865,542 (GRCm39) probably benign Het
Gm7367 T C 7: 59,805,364 (GRCm39) noncoding transcript Het
Gm9312 A T 12: 24,302,095 (GRCm39) noncoding transcript Het
Gmfg A T 7: 28,136,997 (GRCm39) M1L probably benign Het
Gpr149 C A 3: 62,511,794 (GRCm39) L68F possibly damaging Het
Hmga2 T C 10: 120,200,117 (GRCm39) probably benign Het
Il12a C A 3: 68,602,594 (GRCm39) probably benign Het
Itprid1 G A 6: 55,945,220 (GRCm39) G647D possibly damaging Het
Itsn2 T A 12: 4,762,611 (GRCm39) M1597K possibly damaging Het
Kyat3 A G 3: 142,431,187 (GRCm39) I154M probably damaging Het
Npas3 A C 12: 54,108,852 (GRCm39) I419L probably damaging Het
Ogfrl1 T A 1: 23,414,910 (GRCm39) Y199F probably damaging Het
Or14a259 A C 7: 86,013,080 (GRCm39) V155G probably benign Het
Or5aq7 A G 2: 86,938,089 (GRCm39) V214A possibly damaging Het
Or6b6 T C 7: 106,571,354 (GRCm39) M66V probably benign Het
P2rx3 G A 2: 84,855,205 (GRCm39) P84S probably benign Het
P3h3 A G 6: 124,819,099 (GRCm39) V657A probably damaging Het
Pabpc2 A G 18: 39,908,393 (GRCm39) M553V probably benign Het
Pcdhb1 T C 18: 37,398,583 (GRCm39) F178S probably damaging Het
Plppr4 A T 3: 117,116,474 (GRCm39) M403K probably benign Het
Ralgapa2 G A 2: 146,102,288 (GRCm39) T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 (GRCm39) K542N probably benign Het
Rdh8 C T 9: 20,733,925 (GRCm39) A37V probably damaging Het
Rnf213 A G 11: 119,327,502 (GRCm39) T1830A probably damaging Het
Sardh G T 2: 27,105,126 (GRCm39) Q666K possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Serpinb11 G A 1: 107,297,294 (GRCm39) probably null Het
Slc6a6 G A 6: 91,700,452 (GRCm39) G60D probably damaging Het
Tfr2 A G 5: 137,569,996 (GRCm39) D134G probably damaging Het
Tmprss15 T C 16: 78,831,222 (GRCm39) T378A probably benign Het
Tmprss7 T G 16: 45,506,690 (GRCm39) K124T probably benign Het
Urb1 A G 16: 90,571,425 (GRCm39) L1128P probably damaging Het
Usp32 C T 11: 84,994,804 (GRCm39) C36Y possibly damaging Het
Vmn2r50 T A 7: 9,786,922 (GRCm39) T62S probably benign Het
Zfp110 T A 7: 12,578,498 (GRCm39) Y136* probably null Het
Other mutations in Septin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Septin4 APN 11 87,480,599 (GRCm39) missense probably damaging 1.00
IGL00963:Septin4 APN 11 87,474,199 (GRCm39) missense possibly damaging 0.89
IGL01803:Septin4 APN 11 87,459,075 (GRCm39) missense probably benign 0.07
IGL01993:Septin4 APN 11 87,458,555 (GRCm39) missense possibly damaging 0.85
IGL02566:Septin4 APN 11 87,458,468 (GRCm39) missense probably benign 0.00
IGL03087:Septin4 APN 11 87,476,071 (GRCm39) splice site probably benign
IGL03213:Septin4 APN 11 87,458,184 (GRCm39) splice site probably null
IGL03268:Septin4 APN 11 87,480,529 (GRCm39) missense probably damaging 0.99
IGL03388:Septin4 APN 11 87,459,042 (GRCm39) nonsense probably null
R0050:Septin4 UTSW 11 87,458,172 (GRCm39) missense probably damaging 1.00
R0077:Septin4 UTSW 11 87,472,022 (GRCm39) missense probably benign
R1479:Septin4 UTSW 11 87,458,244 (GRCm39) missense probably damaging 1.00
R1729:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1730:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1739:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1762:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1783:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1784:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1785:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1851:Septin4 UTSW 11 87,459,741 (GRCm39) missense probably damaging 1.00
R1862:Septin4 UTSW 11 87,458,061 (GRCm39) missense possibly damaging 0.48
R1913:Septin4 UTSW 11 87,457,838 (GRCm39) missense probably benign
R1957:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R2131:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2133:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2140:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2141:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2252:Septin4 UTSW 11 87,480,637 (GRCm39) missense possibly damaging 0.75
R3149:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3176:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3276:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3696:Septin4 UTSW 11 87,476,060 (GRCm39) missense possibly damaging 0.48
R4018:Septin4 UTSW 11 87,475,947 (GRCm39) missense probably damaging 1.00
R4021:Septin4 UTSW 11 87,458,106 (GRCm39) missense probably damaging 1.00
R4117:Septin4 UTSW 11 87,459,108 (GRCm39) missense probably damaging 1.00
R4193:Septin4 UTSW 11 87,474,142 (GRCm39) critical splice acceptor site probably null
R4196:Septin4 UTSW 11 87,479,598 (GRCm39) missense probably damaging 0.96
R4515:Septin4 UTSW 11 87,458,883 (GRCm39) missense probably benign
R4663:Septin4 UTSW 11 87,458,429 (GRCm39) missense probably damaging 0.98
R4952:Septin4 UTSW 11 87,458,598 (GRCm39) missense probably benign 0.00
R5012:Septin4 UTSW 11 87,475,230 (GRCm39) missense possibly damaging 0.78
R5015:Septin4 UTSW 11 87,458,043 (GRCm39) missense possibly damaging 0.95
R5149:Septin4 UTSW 11 87,480,071 (GRCm39) missense probably damaging 1.00
R5176:Septin4 UTSW 11 87,458,358 (GRCm39) missense probably benign 0.02
R5711:Septin4 UTSW 11 87,458,723 (GRCm39) missense probably benign 0.07
R5891:Septin4 UTSW 11 87,479,750 (GRCm39) unclassified probably benign
R6090:Septin4 UTSW 11 87,480,343 (GRCm39) missense possibly damaging 0.48
R6145:Septin4 UTSW 11 87,476,072 (GRCm39) splice site probably null
R6257:Septin4 UTSW 11 87,481,175 (GRCm39) missense probably benign 0.07
R6305:Septin4 UTSW 11 87,458,145 (GRCm39) missense probably benign 0.00
R6704:Septin4 UTSW 11 87,479,856 (GRCm39) missense probably damaging 1.00
R7064:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R7090:Septin4 UTSW 11 87,475,264 (GRCm39) missense probably damaging 1.00
R7784:Septin4 UTSW 11 87,469,834 (GRCm39) missense probably benign
R7790:Septin4 UTSW 11 87,480,065 (GRCm39) missense probably damaging 1.00
R8320:Septin4 UTSW 11 87,480,560 (GRCm39) missense possibly damaging 0.68
R9289:Septin4 UTSW 11 87,459,792 (GRCm39) nonsense probably null
R9613:Septin4 UTSW 11 87,469,823 (GRCm39) missense possibly damaging 0.53
T0970:Septin4 UTSW 11 87,458,558 (GRCm39) missense probably damaging 0.98
Z1177:Septin4 UTSW 11 87,458,748 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATTGGGACCAAGCCCTC -3'
(R):5'- CTCACAGAAAGGGGTTGAGTC -3'

Sequencing Primer
(F):5'- TCCCCAAAGATTTTAATATCCGAAGC -3'
(R):5'- AGGCGACTTAGGTTCAAGATC -3'
Posted On 2015-06-24