Incidental Mutation 'R4332:Itsn2'
ID323643
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4332 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4712611 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1597 (M1597K)
Ref Sequence ENSEMBL: ENSMUSP00000151900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000111154] [ENSMUST00000219007] [ENSMUST00000220311] [ENSMUST00000220978] [ENSMUST00000222363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062580
AA Change: M1597K

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: M1597K

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218211
Predicted Effect possibly damaging
Transcript: ENSMUST00000219007
AA Change: M1597K

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably benign
Transcript: ENSMUST00000220311
AA Change: M1624K

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000220978
Predicted Effect probably benign
Transcript: ENSMUST00000222363
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
Liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
Stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAGCAGCCTACAGAC -3'
(R):5'- TATGCACACAGAGGCCATG -3'

Sequencing Primer
(F):5'- GCCTACAGACCCTGCCATG -3'
(R):5'- ACAGAGGCCATGCTCTTCC -3'
Posted On2015-06-24