Incidental Mutation 'R4332:Pabpc2'
ID323651
Institutional Source Beutler Lab
Gene Symbol Pabpc2
Ensembl Gene ENSMUSG00000051732
Gene Namepoly(A) binding protein, cytoplasmic 2
SynonymsPabp2
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4332 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location39773497-39776082 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39775340 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 553 (M553V)
Ref Sequence ENSEMBL: ENSMUSP00000066639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063219]
Predicted Effect probably benign
Transcript: ENSMUST00000063219
AA Change: M553V

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066639
Gene: ENSMUSG00000051732
AA Change: M553V

DomainStartEndE-ValueType
RRM 12 85 1.64e-19 SMART
RRM 100 171 7.57e-24 SMART
RRM 192 264 5.23e-27 SMART
RRM 295 366 3.53e-24 SMART
low complexity region 398 413 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
PolyA 546 609 1.69e-27 SMART
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Pabpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Pabpc2 APN 18 39775337 missense possibly damaging 0.78
IGL01295:Pabpc2 APN 18 39774029 missense probably damaging 1.00
IGL02061:Pabpc2 APN 18 39774993 missense probably benign 0.01
IGL02104:Pabpc2 APN 18 39774883 missense possibly damaging 0.65
IGL02513:Pabpc2 APN 18 39775140 missense probably benign 0.08
R0201:Pabpc2 UTSW 18 39775307 missense probably benign 0.01
R0383:Pabpc2 UTSW 18 39775395 missense probably damaging 0.99
R0616:Pabpc2 UTSW 18 39773739 missense possibly damaging 0.94
R0727:Pabpc2 UTSW 18 39775134 missense probably benign 0.00
R1597:Pabpc2 UTSW 18 39773900 missense probably damaging 1.00
R1722:Pabpc2 UTSW 18 39775116 missense probably benign 0.08
R1818:Pabpc2 UTSW 18 39774110 missense probably damaging 1.00
R2230:Pabpc2 UTSW 18 39775070 missense probably benign 0.00
R3087:Pabpc2 UTSW 18 39774266 missense probably benign 0.02
R4080:Pabpc2 UTSW 18 39775530 missense possibly damaging 0.86
R4386:Pabpc2 UTSW 18 39775185 missense probably benign 0.00
R4445:Pabpc2 UTSW 18 39774200 missense probably damaging 1.00
R4718:Pabpc2 UTSW 18 39774503 missense probably benign
R4744:Pabpc2 UTSW 18 39774828 missense probably benign 0.07
R4748:Pabpc2 UTSW 18 39774269 nonsense probably null
R5085:Pabpc2 UTSW 18 39774582 missense probably damaging 1.00
R5113:Pabpc2 UTSW 18 39775383 missense probably benign 0.16
R5994:Pabpc2 UTSW 18 39773894 missense probably benign 0.18
R6216:Pabpc2 UTSW 18 39774719 missense probably damaging 1.00
R6239:Pabpc2 UTSW 18 39773838 missense probably damaging 1.00
R6355:Pabpc2 UTSW 18 39774392 missense probably damaging 0.97
R7221:Pabpc2 UTSW 18 39773910 missense possibly damaging 0.52
R7738:Pabpc2 UTSW 18 39774266 missense possibly damaging 0.78
R7767:Pabpc2 UTSW 18 39774554 missense possibly damaging 0.66
R8059:Pabpc2 UTSW 18 39774822 missense probably benign 0.33
X0024:Pabpc2 UTSW 18 39775397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGATAACAGGTCAGCGTCC -3'
(R):5'- TGGGCAGCCTCTTTAACTTG -3'

Sequencing Primer
(F):5'- CAGCCTCTTCAGCTACAGC -3'
(R):5'- CAGCCTCTTTAACTTGGTGGGC -3'
Posted On2015-06-24