Incidental Mutation 'R4333:Rnf2'
ID323655
Institutional Source Beutler Lab
Gene Symbol Rnf2
Ensembl Gene ENSMUSG00000026484
Gene Namering finger protein 2
SynonymsdinG, Ring1B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4333 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location151458004-151500955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151473076 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000139676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076110] [ENSMUST00000186415] [ENSMUST00000187048] [ENSMUST00000187991] [ENSMUST00000190070]
Predicted Effect probably benign
Transcript: ENSMUST00000076110
AA Change: T245A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075476
Gene: ENSMUSG00000026484
AA Change: T245A

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
Pfam:RAWUL 234 330 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185945
Predicted Effect probably benign
Transcript: ENSMUST00000186415
AA Change: T173A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140594
Gene: ENSMUSG00000026484
AA Change: T173A

DomainStartEndE-ValueType
RING 51 110 3.24e-4 SMART
PDB:3H8H|A 148 258 4e-78 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187048
AA Change: T245A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140896
Gene: ENSMUSG00000026484
AA Change: T245A

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
PDB:3H8H|A 220 330 4e-77 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187991
SMART Domains Protein: ENSMUSP00000140299
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Pfam:zf-C3HC4 51 73 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188871
Predicted Effect possibly damaging
Transcript: ENSMUST00000190070
AA Change: T98A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484
AA Change: T98A

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a null allele show an early growth arrest, failure to progress through gastrulation, impaired epiblast expansion, accumulation of posterior mesoderm and die before E10.5. Mice homozygous for a hypomorphic allele show posterior homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Cadps C T 14: 12,467,031 R967H probably damaging Het
Cwh43 A G 5: 73,441,379 D647G probably damaging Het
Dab2ip T A 2: 35,661,620 *164R probably null Het
Ddx18 A T 1: 121,564,602 D125E probably benign Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Lamp3 T C 16: 19,673,436 I353V probably benign Het
Med13 A G 11: 86,288,183 F1429S probably benign Het
Mybl1 T C 1: 9,672,298 K621E probably damaging Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Olfr573-ps1 A T 7: 102,941,969 L203I possibly damaging Het
Olfr934 A G 9: 38,982,588 I152T possibly damaging Het
Samm50 A G 15: 84,202,830 K280R probably benign Het
Satb2 T C 1: 56,845,586 N511S probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r7 T C 3: 64,690,778 N786S probably damaging Het
Other mutations in Rnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:Rnf2 APN 1 151471695 missense probably benign 0.03
R1913:Rnf2 UTSW 1 151476185 missense probably damaging 1.00
R4965:Rnf2 UTSW 1 151473217 nonsense probably null
R6323:Rnf2 UTSW 1 151473216 missense probably damaging 0.98
R6886:Rnf2 UTSW 1 151473266 missense possibly damaging 0.85
R7386:Rnf2 UTSW 1 151471380 missense probably damaging 1.00
R7474:Rnf2 UTSW 1 151471716 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGAAGAGCAACTTTTCATGG -3'
(R):5'- CCCACTGTAGTAACGCATCC -3'

Sequencing Primer
(F):5'- TTTTCATGGAAAGAATATAAGGAGGG -3'
(R):5'- TGTAGTAACGCATCCACACACAG -3'
Posted On2015-06-24