Incidental Mutation 'R4333:Olfr573-ps1'
ID323664
Institutional Source Beutler Lab
Gene Symbol Olfr573-ps1
Ensembl Gene ENSMUSG00000052785
Gene Nameolfactory receptor 573, pseudogene 1
SynonymsMOR10-3P, MOR10-4, GA_x6K02T2PBJ9-5653743-5652872
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4333 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102941682-102942575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102941969 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 203 (L203I)
Ref Sequence ENSEMBL: ENSMUSP00000146786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064830] [ENSMUST00000210571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064830
AA Change: L203I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065147
Gene: ENSMUSG00000052785
AA Change: L203I

DomainStartEndE-ValueType
Pfam:7tm_4 33 296 9.3e-109 PFAM
Pfam:7tm_1 43 288 4.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064830
AA Change: L203I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000210571
AA Change: L203I

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Cadps C T 14: 12,467,031 R967H probably damaging Het
Cwh43 A G 5: 73,441,379 D647G probably damaging Het
Dab2ip T A 2: 35,661,620 *164R probably null Het
Ddx18 A T 1: 121,564,602 D125E probably benign Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Lamp3 T C 16: 19,673,436 I353V probably benign Het
Med13 A G 11: 86,288,183 F1429S probably benign Het
Mybl1 T C 1: 9,672,298 K621E probably damaging Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Olfr934 A G 9: 38,982,588 I152T possibly damaging Het
Rnf2 T C 1: 151,473,076 T98A possibly damaging Het
Samm50 A G 15: 84,202,830 K280R probably benign Het
Satb2 T C 1: 56,845,586 N511S probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r7 T C 3: 64,690,778 N786S probably damaging Het
Other mutations in Olfr573-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:Olfr573-ps1 UTSW 7 102942051 nonsense probably null
R1537:Olfr573-ps1 UTSW 7 102942340 missense probably damaging 1.00
R2168:Olfr573-ps1 UTSW 7 102942471 missense probably benign 0.00
R3781:Olfr573-ps1 UTSW 7 102942071 missense probably benign
R4198:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4200:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4838:Olfr573-ps1 UTSW 7 102942246 missense probably damaging 1.00
R5041:Olfr573-ps1 UTSW 7 102942578 splice site probably null
R5371:Olfr573-ps1 UTSW 7 102942512 missense probably benign
R5668:Olfr573-ps1 UTSW 7 102941921 missense probably benign 0.44
R7836:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7887:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
R7991:Olfr573-ps1 UTSW 7 102942553 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATATTGGCCATGAGCATGTGC -3'
(R):5'- GACTAGTTGTCTTGGACCGG -3'

Sequencing Primer
(F):5'- CCATGAGCATGTGCACAATTG -3'
(R):5'- TCTTGGACCGGGCAGTCTG -3'
Posted On2015-06-24