Incidental Mutation 'R4333:Med13'
ID 323669
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms Thrap1, 1110067M05Rik, Trap240
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R4333 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 86267033-86357602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86288183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1429 (F1429S)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably benign
Transcript: ENSMUST00000043624
AA Change: F1429S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: F1429S

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Cadps C T 14: 12,467,031 R967H probably damaging Het
Cwh43 A G 5: 73,441,379 D647G probably damaging Het
Dab2ip T A 2: 35,661,620 *164R probably null Het
Ddx18 A T 1: 121,564,602 D125E probably benign Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Lamp3 T C 16: 19,673,436 I353V probably benign Het
Mybl1 T C 1: 9,672,298 K621E probably damaging Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Olfr573-ps1 A T 7: 102,941,969 L203I possibly damaging Het
Olfr934 A G 9: 38,982,588 I152T possibly damaging Het
Rnf2 T C 1: 151,473,076 T98A possibly damaging Het
Samm50 A G 15: 84,202,830 K280R probably benign Het
Satb2 T C 1: 56,845,586 N511S probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r7 T C 3: 64,690,778 N786S probably damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0197_Med13_854 UTSW 11 86307038 missense probably benign 0.13
R0360_Med13_060 UTSW 11 86329161 splice site probably benign
R2359_Med13_079 UTSW 11 86291035 splice site probably benign
R3735_Med13_085 UTSW 11 86279658 missense probably benign 0.00
R4974_Med13_508 UTSW 11 86298847 missense probably damaging 0.98
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R7922:Med13 UTSW 11 86271005 missense probably damaging 0.98
R7943:Med13 UTSW 11 86278526 missense probably damaging 0.97
R8062:Med13 UTSW 11 86319438 missense probably benign
R8075:Med13 UTSW 11 86272470 missense probably damaging 0.98
R8207:Med13 UTSW 11 86303549 missense probably damaging 1.00
R8671:Med13 UTSW 11 86271097 missense probably damaging 1.00
R9056:Med13 UTSW 11 86298834 nonsense probably null
R9084:Med13 UTSW 11 86300795 missense probably damaging 1.00
R9148:Med13 UTSW 11 86301471 missense probably benign 0.27
R9329:Med13 UTSW 11 86298457 missense probably benign 0.10
R9380:Med13 UTSW 11 86286772 missense probably benign 0.42
R9515:Med13 UTSW 11 86308901 missense probably benign 0.00
R9516:Med13 UTSW 11 86288975 missense probably benign 0.01
R9690:Med13 UTSW 11 86278844 missense probably damaging 1.00
R9751:Med13 UTSW 11 86299158 missense probably damaging 1.00
R9752:Med13 UTSW 11 86283321 missense possibly damaging 0.87
R9764:Med13 UTSW 11 86286519 missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCAGAGAATATTTTGGAACC -3'
(R):5'- CCATGCTTTCAACTCAGTTGTTAG -3'

Sequencing Primer
(F):5'- CAGAGCTAGCAGACTTTCTATGGAC -3'
(R):5'- AGAAGGTTTGTTTTAAATGGGTCAAG -3'
Posted On 2015-06-24