Incidental Mutation 'R4334:Iars2'
ID323677
Institutional Source Beutler Lab
Gene Symbol Iars2
Ensembl Gene ENSMUSG00000026618
Gene Nameisoleucine-tRNA synthetase 2, mitochondrial
Synonyms2010002H18Rik
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location185284726-185329396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 185303394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 550 (T550S)
Ref Sequence ENSEMBL: ENSMUSP00000106603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000110975]
Predicted Effect probably benign
Transcript: ENSMUST00000027921
AA Change: T550S

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: T550S

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 3.6e-172 PFAM
Pfam:tRNA-synt_1g 112 268 7e-15 PFAM
Pfam:tRNA-synt_1_2 334 462 3.8e-7 PFAM
Pfam:Anticodon_1 756 920 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110975
AA Change: T550S

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106603
Gene: ENSMUSG00000026618
AA Change: T550S

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 1.2e-171 PFAM
Pfam:tRNA-synt_1g 113 269 3.4e-17 PFAM
Pfam:tRNA-synt_1_2 293 462 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Iars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Iars2 APN 1 185315954 missense probably benign 0.00
IGL00906:Iars2 APN 1 185296403 splice site probably benign
IGL01287:Iars2 APN 1 185296428 missense possibly damaging 0.90
IGL01814:Iars2 APN 1 185302775 nonsense probably null
IGL02016:Iars2 APN 1 185303306 missense probably damaging 0.99
IGL02995:Iars2 APN 1 185303301 missense probably benign
IGL03002:Iars2 APN 1 185322816 splice site probably null
IGL03248:Iars2 APN 1 185291432 unclassified probably benign
R0304:Iars2 UTSW 1 185287156 missense possibly damaging 0.77
R0711:Iars2 UTSW 1 185322388 splice site probably benign
R0783:Iars2 UTSW 1 185320874 missense probably damaging 1.00
R0990:Iars2 UTSW 1 185318627 missense probably damaging 1.00
R1867:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1868:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1957:Iars2 UTSW 1 185295671 missense possibly damaging 0.89
R2378:Iars2 UTSW 1 185327721 missense probably damaging 1.00
R3784:Iars2 UTSW 1 185287131 missense probably benign 0.17
R4061:Iars2 UTSW 1 185303386 missense possibly damaging 0.85
R4708:Iars2 UTSW 1 185289357 missense probably benign 0.00
R4723:Iars2 UTSW 1 185315979 missense probably damaging 1.00
R4729:Iars2 UTSW 1 185316051 missense possibly damaging 0.71
R4851:Iars2 UTSW 1 185327648 missense probably damaging 0.99
R5033:Iars2 UTSW 1 185317928 missense possibly damaging 0.65
R5215:Iars2 UTSW 1 185294769 missense probably damaging 1.00
R5260:Iars2 UTSW 1 185323734 missense probably damaging 1.00
R5286:Iars2 UTSW 1 185323121 intron probably benign
R5614:Iars2 UTSW 1 185289508 missense probably benign 0.00
R6659:Iars2 UTSW 1 185288076 missense possibly damaging 0.76
R6838:Iars2 UTSW 1 185329145 missense probably damaging 0.98
R7057:Iars2 UTSW 1 185289367 missense probably benign 0.03
R7462:Iars2 UTSW 1 185322866 missense probably damaging 1.00
R7690:Iars2 UTSW 1 185320997 missense probably damaging 1.00
R8021:Iars2 UTSW 1 185322457 missense not run
Z1177:Iars2 UTSW 1 185315895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCACTGCTATGCTACAGAGG -3'
(R):5'- TTACCACTTAGAACACAGCTGTC -3'

Sequencing Primer
(F):5'- CTACAGAGGATGTTTTGACTGCAAG -3'
(R):5'- GCTGTCAGCGCCATCTTATAATG -3'
Posted On2015-06-24