Incidental Mutation 'R4334:Foxa2'
ID323681
Institutional Source Beutler Lab
Gene Symbol Foxa2
Ensembl Gene ENSMUSG00000037025
Gene Nameforkhead box A2
SynonymsHnf-3b, Hnf3b, Tcf-3b, HNF3-beta, Tcf3b, HNF3beta
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4334 (G1)
Quality Score179
Status Not validated
Chromosome2
Chromosomal Location148042877-148046969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148044703 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 64 (N64S)
Ref Sequence ENSEMBL: ENSMUSP00000045918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047315] [ENSMUST00000109964] [ENSMUST00000172928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047315
AA Change: N64S

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045918
Gene: ENSMUSG00000037025
AA Change: N64S

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 44 67 N/A INTRINSIC
low complexity region 74 104 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
FH 157 247 4.77e-62 SMART
low complexity region 262 281 N/A INTRINSIC
low complexity region 326 365 N/A INTRINSIC
Pfam:HNF_C 374 448 1.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109964
AA Change: N70S

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105590
Gene: ENSMUSG00000037025
AA Change: N70S

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 50 73 N/A INTRINSIC
low complexity region 80 110 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
FH 163 253 4.77e-62 SMART
low complexity region 268 287 N/A INTRINSIC
low complexity region 332 371 N/A INTRINSIC
Pfam:HNF_C 380 454 5.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146242
Predicted Effect probably benign
Transcript: ENSMUST00000172928
SMART Domains Protein: ENSMUSP00000134081
Gene: ENSMUSG00000037025

DomainStartEndE-ValueType
FH 13 72 1.94e-12 SMART
low complexity region 87 106 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
Pfam:HNF_C 199 273 4.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Embryos homozygous for targeted null mutations fail to form a distinct node, lack a notochord, and die by embryonic day 10 or 11. Mutants also exhibit defects of somite and neural tube organization, and lack a floor plate and motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Foxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Foxa2 APN 2 148044818 missense possibly damaging 0.93
IGL02560:Foxa2 APN 2 148044031 missense probably benign 0.40
IGL02797:Foxa2 APN 2 148044125 missense possibly damaging 0.95
R6768_Foxa2_027 UTSW 2 148043827 missense probably damaging 0.97
R0116:Foxa2 UTSW 2 148043561 missense probably damaging 0.99
R2252:Foxa2 UTSW 2 148044166 missense probably damaging 0.98
R5293:Foxa2 UTSW 2 148044002 missense probably benign 0.09
R5339:Foxa2 UTSW 2 148044434 missense probably damaging 1.00
R6768:Foxa2 UTSW 2 148043827 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATCGAGTTCATGTTGGCG -3'
(R):5'- AGATTCCAGAGGCTTGCACG -3'

Sequencing Primer
(F):5'- ATCGAGTTCATGTTGGCGTAGGG -3'
(R):5'- ATTCCAGAGGCTTGCACGAATTG -3'
Posted On2015-06-24