Incidental Mutation 'R4334:Micall2'
ID323691
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene NameMICAL-like 2
SynonymsA930021H16Rik, Jrab, MICAL-L2
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139706696-139736336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139713350 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 527 (E527G)
Ref Sequence ENSEMBL: ENSMUSP00000127937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
Predicted Effect unknown
Transcript: ENSMUST00000044642
AA Change: E610G
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: E610G

DomainStartEndE-ValueType
CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164584
Predicted Effect probably benign
Transcript: ENSMUST00000165645
Predicted Effect probably damaging
Transcript: ENSMUST00000170773
AA Change: E527G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: E527G

DomainStartEndE-ValueType
SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139717556 critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139716328 missense probably benign 0.01
IGL02641:Micall2 APN 5 139719339 missense probably damaging 1.00
IGL03245:Micall2 APN 5 139719259 missense probably damaging 1.00
IGL03252:Micall2 APN 5 139716726 missense probably benign 0.01
R1214:Micall2 UTSW 5 139711641 missense probably damaging 0.97
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1831:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1833:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1969:Micall2 UTSW 5 139736130 missense probably damaging 1.00
R2023:Micall2 UTSW 5 139717511 missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139711562 missense probably damaging 0.98
R2330:Micall2 UTSW 5 139717515 missense probably damaging 1.00
R3820:Micall2 UTSW 5 139715856 missense possibly damaging 0.92
R4299:Micall2 UTSW 5 139709471 intron probably benign
R4451:Micall2 UTSW 5 139707097 missense probably damaging 1.00
R4769:Micall2 UTSW 5 139706886 missense probably damaging 0.97
R4911:Micall2 UTSW 5 139716825 missense probably damaging 1.00
R4996:Micall2 UTSW 5 139710589 missense probably benign 0.31
R5118:Micall2 UTSW 5 139716447 missense probably damaging 1.00
R5155:Micall2 UTSW 5 139710231 missense probably damaging 1.00
R5475:Micall2 UTSW 5 139716469 missense probably damaging 1.00
R5750:Micall2 UTSW 5 139715701 splice site probably null
R5998:Micall2 UTSW 5 139706911 critical splice acceptor site probably null
R6181:Micall2 UTSW 5 139716751 missense probably benign 0.41
R6852:Micall2 UTSW 5 139715793 missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139708944 unclassified probably benign
R7395:Micall2 UTSW 5 139716369 missense possibly damaging 0.78
Z1088:Micall2 UTSW 5 139706894 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139716295 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AACACTTGTGGAGCAGCAG -3'
(R):5'- CTTTGGGCCATCTATCTGAGG -3'

Sequencing Primer
(F):5'- TTGTGGAGCAGCAGACCCC -3'
(R):5'- CATCTATCTGAGGGTAGATTGTCCAC -3'
Posted On2015-06-24