Incidental Mutation 'R0004:Sec23b'
ID32371
Institutional Source Beutler Lab
Gene Symbol Sec23b
Ensembl Gene ENSMUSG00000027429
Gene NameSEC23 homolog B, COPII coat complex component
Synonyms
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location144556229-144590749 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 144564562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028916] [ENSMUST00000143573] [ENSMUST00000149697] [ENSMUST00000155876]
Predicted Effect probably benign
Transcript: ENSMUST00000028916
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128210
Predicted Effect probably benign
Transcript: ENSMUST00000143573
SMART Domains Protein: ENSMUSP00000120972
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 3.7e-18 PFAM
Pfam:Sec23_trunk 126 278 1.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149697
SMART Domains Protein: ENSMUSP00000122819
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155876
SMART Domains Protein: ENSMUSP00000122884
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, fail to suckle, and show degeneration of the secretory tissues in the pancreas, salivary gland, and gastric glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Sec23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Sec23b APN 2 144583770 critical splice donor site probably null
IGL00668:Sec23b APN 2 144559218 utr 5 prime probably benign
IGL00714:Sec23b APN 2 144559225 missense probably benign 0.33
IGL00914:Sec23b APN 2 144566864 missense probably damaging 1.00
IGL01084:Sec23b APN 2 144564589 missense possibly damaging 0.81
IGL01341:Sec23b APN 2 144585733 missense probably benign 0.00
IGL01377:Sec23b APN 2 144559237 missense probably damaging 0.97
IGL01634:Sec23b APN 2 144559230 missense probably damaging 0.96
IGL02321:Sec23b APN 2 144579405 critical splice donor site probably null
IGL03027:Sec23b APN 2 144587545 missense possibly damaging 0.55
IGL03064:Sec23b APN 2 144582032 missense probably benign 0.00
IGL03105:Sec23b APN 2 144582020 missense probably damaging 1.00
IGL03240:Sec23b APN 2 144566759 splice site probably benign
R0092:Sec23b UTSW 2 144566910 missense probably benign 0.21
R0409:Sec23b UTSW 2 144567912 missense probably benign 0.22
R0426:Sec23b UTSW 2 144568612 unclassified probably benign
R0441:Sec23b UTSW 2 144581997 missense probably damaging 1.00
R1034:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R1624:Sec23b UTSW 2 144567129 missense probably benign
R2020:Sec23b UTSW 2 144566944 missense possibly damaging 0.49
R2392:Sec23b UTSW 2 144585587 splice site probably null
R3946:Sec23b UTSW 2 144581973 missense probably benign
R4407:Sec23b UTSW 2 144574718 missense possibly damaging 0.53
R4448:Sec23b UTSW 2 144559251 missense probably benign 0.43
R4519:Sec23b UTSW 2 144582015 missense possibly damaging 0.86
R4522:Sec23b UTSW 2 144578366 missense possibly damaging 0.80
R4654:Sec23b UTSW 2 144572574 missense probably benign 0.33
R4849:Sec23b UTSW 2 144585599 missense probably damaging 0.96
R4876:Sec23b UTSW 2 144586361 splice site probably null
R4983:Sec23b UTSW 2 144581953 missense probably benign 0.06
R6169:Sec23b UTSW 2 144586974 missense probably damaging 1.00
R6702:Sec23b UTSW 2 144559189 splice site probably null
R6703:Sec23b UTSW 2 144559189 splice site probably null
R6748:Sec23b UTSW 2 144566794 missense probably damaging 1.00
R7238:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R7511:Sec23b UTSW 2 144590349 missense probably benign 0.30
R7845:Sec23b UTSW 2 144559396 missense possibly damaging 0.67
R7914:Sec23b UTSW 2 144564645 missense probably benign
R8177:Sec23b UTSW 2 144585623 missense probably benign 0.03
R8183:Sec23b UTSW 2 144559269 missense probably benign 0.08
R8238:Sec23b UTSW 2 144564648 missense probably benign 0.00
R8420:Sec23b UTSW 2 144559314 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGTGCCATGCATAGCTGGAG -3'
(R):5'- TGGGTCAAGACCTGAAAATAACGCC -3'

Sequencing Primer
(F):5'- CATAGCTGGAGCTGGAGC -3'
(R):5'- GAACATATTGTCTAGAATCCTGCTCC -3'
Posted On2013-05-09