Incidental Mutation 'R4334:Abca17'
ID323714
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24318268 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 447 (V447E)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: V447E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V447E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: V447E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V447E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACTTACTGGTGTCCGAGATC -3'
(R):5'- ACTAAGGAACATGGTTTTGGGG -3'

Sequencing Primer
(F):5'- CTGGTGTCCGAGATCTTAATTAGTAC -3'
(R):5'- AGTGGCCTCAGTTCAATGAC -3'
Posted On2015-06-24