Incidental Mutation 'R4335:Sp9'
ID323724
Institutional Source Beutler Lab
Gene Symbol Sp9
Ensembl Gene ENSMUSG00000068859
Gene Nametrans-acting transcription factor 9
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R4335 (G1)
Quality Score222
Status Not validated
Chromosome2
Chromosomal Location73271925-73284706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73274289 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 396 (V396M)
Ref Sequence ENSEMBL: ENSMUSP00000088322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090813]
Predicted Effect probably damaging
Transcript: ENSMUST00000090813
AA Change: V396M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088322
Gene: ENSMUSG00000068859
AA Change: V396M

DomainStartEndE-ValueType
low complexity region 53 65 N/A INTRINSIC
low complexity region 71 88 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 268 306 N/A INTRINSIC
ZnF_C2H2 332 356 2.63e0 SMART
ZnF_C2H2 362 386 1.84e-4 SMART
ZnF_C2H2 392 414 5.99e-4 SMART
low complexity region 416 427 N/A INTRINSIC
low complexity region 452 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147133
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Sp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03129:Sp9 APN 2 73273521 missense probably benign 0.00
R0604:Sp9 UTSW 2 73273638 missense probably benign 0.00
R0718:Sp9 UTSW 2 73273827 missense possibly damaging 0.70
R3423:Sp9 UTSW 2 73273971 missense probably benign 0.00
R3747:Sp9 UTSW 2 73274308 missense probably damaging 0.98
R4873:Sp9 UTSW 2 73273618 missense possibly damaging 0.86
R4875:Sp9 UTSW 2 73273618 missense possibly damaging 0.86
R5341:Sp9 UTSW 2 73274514 missense possibly damaging 0.92
R5389:Sp9 UTSW 2 73274297 missense probably damaging 0.99
R5891:Sp9 UTSW 2 73274251 missense probably damaging 1.00
R6938:Sp9 UTSW 2 73273272 missense probably damaging 0.99
R7092:Sp9 UTSW 2 73273771 missense probably damaging 0.99
R7699:Sp9 UTSW 2 73273380 missense probably damaging 0.98
R8336:Sp9 UTSW 2 73274452 missense possibly damaging 0.86
Z1088:Sp9 UTSW 2 73273230 missense possibly damaging 0.94
Z1176:Sp9 UTSW 2 73273456 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCACAGCTGTCACATCC -3'
(R):5'- ACCTCTAGGAGTCGTTGGGAC -3'

Sequencing Primer
(F):5'- TGTCACATCCCGGGCTGTG -3'
(R):5'- ACCGGTCGCAGCTTCCTTG -3'
Posted On2015-06-24