Incidental Mutation 'R4335:Selenot'
ID323725
Institutional Source Beutler Lab
Gene Symbol Selenot
Ensembl Gene ENSMUSG00000075700
Gene Nameselenoprotein T
SynonymsSelt, 5730408P04Rik, SelT, 2810407C02Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58576636-58593133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58585301 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 70 (R70S)
Ref Sequence ENSEMBL: ENSMUSP00000103557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107924]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107924
AA Change: R70S

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103557
Gene: ENSMUSG00000075700
AA Change: R70S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Rdx 40 179 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125815
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in beta cells exhibit impaired glucose tolerance, increased circulating glucose levels, decreased circulating insulin levels, decreased insulin secretion and an increase in smaller islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Selenot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Selenot APN 3 58586082 splice site probably benign
R5023:Selenot UTSW 3 58588453 frame shift probably null
R5078:Selenot UTSW 3 58585271 missense probably damaging 1.00
R5353:Selenot UTSW 3 58585966 missense possibly damaging 0.78
R5554:Selenot UTSW 3 58576875 critical splice donor site probably null
R5691:Selenot UTSW 3 58586026 missense probably benign 0.38
R6137:Selenot UTSW 3 58585284 missense probably damaging 1.00
R7532:Selenot UTSW 3 58585232 missense probably benign 0.01
R8482:Selenot UTSW 3 58588468 missense probably damaging 1.00
R8504:Selenot UTSW 3 58585277 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CCCTGTATCTGTTGTTGAGTTCAG -3'
(R):5'- TTCATCCCGTGTATTATTTACAAAGT -3'

Sequencing Primer
(F):5'- GTAGAGTTTACTTGTCTTTAAGTC -3'
(R):5'- CCAGCAAGGGTGACTAAAT -3'
Posted On2015-06-24