Incidental Mutation 'R4335:Clic4'
ID323730
Institutional Source Beutler Lab
Gene Symbol Clic4
Ensembl Gene ENSMUSG00000037242
Gene Namechloride intracellular channel 4 (mitochondrial)
SynonymsD0Jmb3, mc3s5, mtCLIC
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4335 (G1)
Quality Score208
Status Not validated
Chromosome4
Chromosomal Location135213969-135272814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135218605 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 167 (S167N)
Ref Sequence ENSEMBL: ENSMUSP00000041453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037099]
Predicted Effect probably benign
Transcript: ENSMUST00000037099
AA Change: S167N

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041453
Gene: ENSMUSG00000037242
AA Change: S167N

DomainStartEndE-ValueType
Pfam:GST_N_3 31 103 7.3e-9 PFAM
Pfam:GST_C_2 134 223 2.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143370
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations may display decreased survival, body weight and female fertility, impaired angiogenesis, increased suscpetibility to Listeria infection, increased resistance to LPS treatment, skin erosions and/or delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Clic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Clic4 APN 4 135217193 missense probably damaging 0.99
IGL01674:Clic4 APN 4 135238893 missense probably benign 0.01
IGL03343:Clic4 APN 4 135218578 missense possibly damaging 0.91
IGL03372:Clic4 APN 4 135218614 missense probably damaging 0.99
R1643:Clic4 UTSW 4 135238895 missense possibly damaging 0.69
R2201:Clic4 UTSW 4 135223539 missense probably damaging 1.00
R4181:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4302:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4600:Clic4 UTSW 4 135238989 splice site probably null
R4939:Clic4 UTSW 4 135223541 missense probably benign 0.16
R5359:Clic4 UTSW 4 135217135 missense probably benign 0.00
R5437:Clic4 UTSW 4 135217246 missense probably damaging 1.00
R5902:Clic4 UTSW 4 135272558 missense probably benign
R7670:Clic4 UTSW 4 135217205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGAGCTGACTCTGGCTG -3'
(R):5'- GTTGGTTGGCAGGATAGACC -3'

Sequencing Primer
(F):5'- CTCTGGCTGGGGTAGAGAAC -3'
(R):5'- AGCATGCAGGCAAGCTC -3'
Posted On2015-06-24