Incidental Mutation 'R4335:Tbc1d19'
ID323733
Institutional Source Beutler Lab
Gene Symbol Tbc1d19
Ensembl Gene ENSMUSG00000039178
Gene NameTBC1 domain family, member 19
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location53809606-53903965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53872277 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 327 (T327A)
Ref Sequence ENSEMBL: ENSMUSP00000040585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037337] [ENSMUST00000201958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037337
AA Change: T327A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040585
Gene: ENSMUSG00000039178
AA Change: T327A

DomainStartEndE-ValueType
TBC 248 496 8.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201958
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Tbc1d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Tbc1d19 APN 5 53897062 nonsense probably null
IGL01684:Tbc1d19 APN 5 53856879 missense probably benign 0.31
IGL02476:Tbc1d19 APN 5 53889413 splice site probably null
IGL02869:Tbc1d19 APN 5 53835217 missense probably benign 0.02
IGL03036:Tbc1d19 APN 5 53897047 missense probably damaging 1.00
IGL03099:Tbc1d19 APN 5 53883655 splice site probably benign
LCD18:Tbc1d19 UTSW 5 53816709 intron probably benign
R0194:Tbc1d19 UTSW 5 53860156 missense probably damaging 1.00
R1729:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1776:Tbc1d19 UTSW 5 53889311 splice site probably null
R1784:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1902:Tbc1d19 UTSW 5 53829353 missense probably benign 0.00
R3431:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R3432:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R4333:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4681:Tbc1d19 UTSW 5 53872253 missense probably damaging 1.00
R4812:Tbc1d19 UTSW 5 53809806 missense probably damaging 0.99
R5178:Tbc1d19 UTSW 5 53889325 missense possibly damaging 0.84
R5214:Tbc1d19 UTSW 5 53849841 missense probably benign 0.00
R6265:Tbc1d19 UTSW 5 53837924 missense probably benign 0.06
R6372:Tbc1d19 UTSW 5 53856910 missense possibly damaging 0.55
R6494:Tbc1d19 UTSW 5 53829383 missense probably benign 0.13
R6495:Tbc1d19 UTSW 5 53889213 splice site probably null
R6612:Tbc1d19 UTSW 5 53809845 missense possibly damaging 0.88
R6787:Tbc1d19 UTSW 5 53835249 splice site probably null
R6965:Tbc1d19 UTSW 5 53856924 critical splice donor site probably null
R7275:Tbc1d19 UTSW 5 53872276 missense probably damaging 1.00
R7642:Tbc1d19 UTSW 5 53856918 missense probably damaging 0.98
R7655:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
R7656:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
R8314:Tbc1d19 UTSW 5 53897047 missense probably damaging 1.00
R8479:Tbc1d19 UTSW 5 53883689 missense possibly damaging 0.83
X0026:Tbc1d19 UTSW 5 53835247 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGCTCTTCCCATTGCAAAG -3'
(R):5'- AGAGGGTTCTGTGATCTGCC -3'

Sequencing Primer
(F):5'- TTGCAAAGCCCAGCACTG -3'
(R):5'- CCTGGGTGCTGACATTGAAAG -3'
Posted On2015-06-24