Incidental Mutation 'R4335:Tsga13'
ID323734
Institutional Source Beutler Lab
Gene Symbol Tsga13
Ensembl Gene ENSMUSG00000039032
Gene Nametestis specific gene A13
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30896981-30915573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30900045 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 179 (D179G)
Ref Sequence ENSEMBL: ENSMUSP00000040894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048580] [ENSMUST00000048774] [ENSMUST00000166192]
Predicted Effect probably damaging
Transcript: ENSMUST00000048580
AA Change: D179G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040894
Gene: ENSMUSG00000039032
AA Change: D179G

DomainStartEndE-ValueType
Pfam:TSGA13 3 271 9.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135230
SMART Domains Protein: ENSMUSP00000119995
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 246 1.3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151973
Predicted Effect probably benign
Transcript: ENSMUST00000166192
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202703
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Tsga13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Tsga13 APN 6 30913566 missense possibly damaging 0.47
IGL02487:Tsga13 APN 6 30907427 missense probably damaging 1.00
IGL02602:Tsga13 APN 6 30902277 missense possibly damaging 0.92
R3894:Tsga13 UTSW 6 30912263 missense probably benign
R4582:Tsga13 UTSW 6 30902363 missense probably benign 0.04
R5705:Tsga13 UTSW 6 30900016 missense probably damaging 1.00
R6248:Tsga13 UTSW 6 30897204 missense probably benign 0.01
R7470:Tsga13 UTSW 6 30900046 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GGGCAGGAAACCCTATACTTC -3'
(R):5'- TGTGTTAAGCTCTCAAACCCTAC -3'

Sequencing Primer
(F):5'- GGCAGGAAACCCTATACTTCTTGAAC -3'
(R):5'- GTTAAGCTCTCAAACCCTACCCTCC -3'
Posted On2015-06-24