Incidental Mutation 'R4335:Fsd2'
ID323740
Institutional Source Beutler Lab
Gene Symbol Fsd2
Ensembl Gene ENSMUSG00000038663
Gene Namefibronectin type III and SPRY domain containing 2
SynonymsSpryd1, 9830160G03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81533308-81566944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81542065 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 521 (S521R)
Ref Sequence ENSEMBL: ENSMUSP00000047775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042318]
Predicted Effect probably damaging
Transcript: ENSMUST00000042318
AA Change: S521R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047775
Gene: ENSMUSG00000038663
AA Change: S521R

DomainStartEndE-ValueType
low complexity region 102 121 N/A INTRINSIC
coiled coil region 204 231 N/A INTRINSIC
FN3 315 400 7.34e-9 SMART
FN3 412 494 2e-1 SMART
Pfam:PRY 509 558 8.6e-9 PFAM
Pfam:SPRY 564 683 2.8e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FN3/SPRY family of proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Fsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Fsd2 APN 7 81553007 missense probably benign 0.15
IGL02012:Fsd2 APN 7 81549914 missense probably benign 0.00
IGL02061:Fsd2 APN 7 81540424 nonsense probably null
IGL02971:Fsd2 APN 7 81548923 nonsense probably null
IGL03207:Fsd2 APN 7 81559170 missense probably benign 0.28
IGL03344:Fsd2 APN 7 81559909 missense probably benign 0.00
R0142:Fsd2 UTSW 7 81559935 missense probably damaging 0.98
R0540:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0607:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0846:Fsd2 UTSW 7 81540397 missense probably benign 0.00
R0863:Fsd2 UTSW 7 81542165 missense possibly damaging 0.47
R1172:Fsd2 UTSW 7 81559770 missense probably benign
R1173:Fsd2 UTSW 7 81559770 missense probably benign
R1175:Fsd2 UTSW 7 81559770 missense probably benign
R1438:Fsd2 UTSW 7 81548873 missense probably benign 0.13
R1456:Fsd2 UTSW 7 81559591 nonsense probably null
R1717:Fsd2 UTSW 7 81535109 missense probably benign 0.23
R1987:Fsd2 UTSW 7 81559659 missense possibly damaging 0.89
R2698:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4108:Fsd2 UTSW 7 81544967 missense probably benign 0.01
R4165:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4570:Fsd2 UTSW 7 81559770 missense probably benign
R4707:Fsd2 UTSW 7 81559680 missense probably damaging 1.00
R4741:Fsd2 UTSW 7 81551895 critical splice donor site probably null
R4863:Fsd2 UTSW 7 81552964 missense probably null 0.91
R5281:Fsd2 UTSW 7 81552985 missense probably benign 0.15
R5898:Fsd2 UTSW 7 81537227 missense probably damaging 1.00
R6812:Fsd2 UTSW 7 81535089 missense probably benign 0.00
R7367:Fsd2 UTSW 7 81535180 missense probably damaging 1.00
R7976:Fsd2 UTSW 7 81559881 missense probably benign 0.00
Z1176:Fsd2 UTSW 7 81553192 missense probably damaging 1.00
Z1177:Fsd2 UTSW 7 81559752 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGAATGTGGTAAAACCGTC -3'
(R):5'- ATCTGAGCGTCTTGGCTGAG -3'

Sequencing Primer
(F):5'- TCAGCCTGGTCTACAAAGTG -3'
(R):5'- CTGTGGGTCAGAGGACAGTG -3'
Posted On2015-06-24