Incidental Mutation 'R4335:Erh'
ID323748
Institutional Source Beutler Lab
Gene Symbol Erh
Ensembl Gene ENSMUSG00000021131
Gene NameERH mRNA splicing and mitosis factor
SynonymsPrei1, Mer
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80634022-80644341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80642841 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 3 (L3P)
Ref Sequence ENSEMBL: ENSMUSP00000129620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021559] [ENSMUST00000085245] [ENSMUST00000166931] [ENSMUST00000217889] [ENSMUST00000218364] [ENSMUST00000218740] [ENSMUST00000219405] [ENSMUST00000219706]
Predicted Effect probably benign
Transcript: ENSMUST00000021559
SMART Domains Protein: ENSMUSP00000021559
Gene: ENSMUSG00000021131

DomainStartEndE-ValueType
Pfam:ER 1 103 9.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085245
SMART Domains Protein: ENSMUSP00000082343
Gene: ENSMUSG00000048833

DomainStartEndE-ValueType
Pfam:Zip 4 146 2.6e-13 PFAM
Pfam:Zip 132 303 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166931
AA Change: L3P

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129620
Gene: ENSMUSG00000021131
AA Change: L3P

DomainStartEndE-ValueType
Pfam:ER 21 118 4.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218336
Predicted Effect probably benign
Transcript: ENSMUST00000218364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218440
Predicted Effect probably benign
Transcript: ENSMUST00000218740
Predicted Effect probably benign
Transcript: ENSMUST00000219405
Predicted Effect probably benign
Transcript: ENSMUST00000219706
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Erh
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2198:Erh UTSW 12 80642785 unclassified probably benign
R7466:Erh UTSW 12 80640983 missense probably benign 0.10
R7679:Erh UTSW 12 80637571 missense probably benign 0.25
R8039:Erh UTSW 12 80637578 missense probably damaging 1.00
Z1176:Erh UTSW 12 80642804 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACAAGCTATTCATTCTTTGCCAC -3'
(R):5'- AGGGTCCTGGTCCCAAAATC -3'

Sequencing Primer
(F):5'- TTTGAAAACTATAAACACACCTGCTC -3'
(R):5'- AATGAGATCCCCTGGGTCTG -3'
Posted On2015-06-24