Incidental Mutation 'R4335:Omd'
ID323749
Institutional Source Beutler Lab
Gene Symbol Omd
Ensembl Gene ENSMUSG00000048368
Gene Nameosteomodulin
Synonymsosteoadherin, OSAD, SLRR2C
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49582462-49592822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49590236 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 254 (D254A)
Ref Sequence ENSEMBL: ENSMUSP00000152066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000065494] [ENSMUST00000221170]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065494
AA Change: D254A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065706
Gene: ENSMUSG00000048368
AA Change: D254A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 61 95 3.14e-11 SMART
LRR 115 139 2.15e2 SMART
LRR 140 160 2.2e1 SMART
LRR 162 184 4.21e1 SMART
LRR 185 210 1.01e2 SMART
LRR 211 234 6.96e0 SMART
LRR 235 255 8.49e1 SMART
LRR 256 279 1.76e-1 SMART
LRR 300 322 7.8e1 SMART
Blast:LRR 330 353 6e-8 BLAST
low complexity region 385 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221170
AA Change: D254A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired cued contextual conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Omd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Omd APN 13 49589643 nonsense probably null
IGL01982:Omd APN 13 49589497 missense possibly damaging 0.88
IGL02678:Omd APN 13 49592281 missense probably benign 0.37
IGL03069:Omd APN 13 49592394 utr 3 prime probably benign
R1036:Omd UTSW 13 49589971 missense probably damaging 1.00
R3954:Omd UTSW 13 49589737 missense probably benign 0.00
R4030:Omd UTSW 13 49589649 missense probably benign 0.08
R5095:Omd UTSW 13 49589698 missense possibly damaging 0.95
R5137:Omd UTSW 13 49590076 missense probably benign 0.05
R5400:Omd UTSW 13 49592227 missense probably benign 0.37
R5596:Omd UTSW 13 49592338 missense probably benign 0.16
R5930:Omd UTSW 13 49589636 missense possibly damaging 0.63
R6132:Omd UTSW 13 49590367 missense probably damaging 0.97
R6294:Omd UTSW 13 49589991 missense probably damaging 1.00
R6454:Omd UTSW 13 49589869 missense probably damaging 0.99
R6680:Omd UTSW 13 49589528 missense possibly damaging 0.74
R6704:Omd UTSW 13 49589873 missense probably damaging 1.00
R6932:Omd UTSW 13 49590234 missense probably damaging 1.00
R7427:Omd UTSW 13 49592269 missense possibly damaging 0.68
R7884:Omd UTSW 13 49590154 missense probably damaging 1.00
R7971:Omd UTSW 13 49590254 missense probably benign 0.00
R8129:Omd UTSW 13 49592089 missense probably damaging 0.99
R8399:Omd UTSW 13 49589869 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGACTATGCTTGACCTCTGC -3'
(R):5'- CCATTCTTTCATCAGACATGTTGG -3'

Sequencing Primer
(F):5'- GACTATGCTTGACCTCTGCTATAATC -3'
(R):5'- GTGTCCAACGTTGAGTTCTA -3'
Posted On2015-06-24