Incidental Mutation 'R4335:Kcnv1'
ID323750
Institutional Source Beutler Lab
Gene Symbol Kcnv1
Ensembl Gene ENSMUSG00000022342
Gene Namepotassium channel, subfamily V, member 1
Synonyms2700023A03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4335 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location45106284-45114920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45114444 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 66 (T66M)
Ref Sequence ENSEMBL: ENSMUSP00000022967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022967]
Predicted Effect probably damaging
Transcript: ENSMUST00000022967
AA Change: T66M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022967
Gene: ENSMUSG00000022342
AA Change: T66M

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
BTB 42 160 1.17e-12 SMART
Pfam:Ion_trans 212 440 8.9e-45 PFAM
Pfam:Ion_trans_2 350 436 3.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228536
Meta Mutation Damage Score 0.9059 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
PHENOTYPE: At weaning, homozygous mutant mice exhibit tetany, tremors and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Abca9 G A 11: 110,152,017 T402M probably damaging Het
Apbb1ip G A 2: 22,871,562 probably null Het
Armh1 A T 4: 117,214,463 I308N probably damaging Het
Ceacam5 G A 7: 17,752,129 R517Q probably benign Het
Clic4 C T 4: 135,218,605 S167N probably benign Het
Ehbp1l1 A T 19: 5,708,769 L1644Q probably damaging Het
Erh A G 12: 80,642,841 L3P probably benign Het
Fam71d T C 12: 78,712,232 S109P possibly damaging Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fsd2 A T 7: 81,542,065 S521R probably damaging Het
Hace1 A G 10: 45,709,961 Y865C probably damaging Het
Iqcf1 G A 9: 106,501,873 R62H possibly damaging Het
Leng8 T C 7: 4,147,038 Y781H probably damaging Het
Med8 G T 4: 118,409,370 probably null Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Nat8f2 A G 6: 85,868,251 L43P probably damaging Het
Omd A C 13: 49,590,236 D254A probably benign Het
Psd2 G T 18: 36,007,530 A622S probably damaging Het
Rnf207 G A 4: 152,315,605 probably benign Het
Rsbn1l T C 5: 20,908,193 I444V probably null Het
Rxfp1 A G 3: 79,686,798 probably null Het
Selenot C A 3: 58,585,301 R70S possibly damaging Het
Sox6 A G 7: 115,512,724 S557P probably benign Het
Sp9 G A 2: 73,274,289 V396M probably damaging Het
Ston1 T C 17: 88,635,697 F177S probably damaging Het
Syne2 A G 12: 76,028,092 E4602G probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Tsga13 T C 6: 30,900,045 D179G probably damaging Het
Wdr27 T A 17: 14,920,756 probably null Het
Other mutations in Kcnv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Kcnv1 APN 15 45113228 missense probably benign 0.00
IGL02227:Kcnv1 APN 15 45114274 missense probably damaging 1.00
IGL02472:Kcnv1 APN 15 45109123 nonsense probably null
IGL03239:Kcnv1 APN 15 45109490 splice site probably benign
R0079:Kcnv1 UTSW 15 45113333 missense probably damaging 1.00
R0534:Kcnv1 UTSW 15 45109249 missense probably damaging 0.98
R0627:Kcnv1 UTSW 15 45112881 splice site probably benign
R1614:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R1615:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R2942:Kcnv1 UTSW 15 45109185 missense probably damaging 1.00
R4244:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4290:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4291:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4293:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4294:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4295:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4342:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4345:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4354:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4934:Kcnv1 UTSW 15 45109248 missense probably damaging 1.00
R5240:Kcnv1 UTSW 15 45113244 missense probably damaging 1.00
R5295:Kcnv1 UTSW 15 45114591 missense unknown
R5631:Kcnv1 UTSW 15 45109357 missense probably damaging 1.00
R5669:Kcnv1 UTSW 15 45114252 missense possibly damaging 0.71
R5762:Kcnv1 UTSW 15 45109122 missense probably damaging 0.99
R5776:Kcnv1 UTSW 15 45114567 missense unknown
R5787:Kcnv1 UTSW 15 45114330 missense probably damaging 1.00
R5980:Kcnv1 UTSW 15 45109414 missense probably damaging 0.99
R6819:Kcnv1 UTSW 15 45109117 missense probably damaging 0.99
R6851:Kcnv1 UTSW 15 45109198 missense probably damaging 1.00
R6997:Kcnv1 UTSW 15 45114601 missense unknown
R7254:Kcnv1 UTSW 15 45113208 missense probably benign 0.00
R7258:Kcnv1 UTSW 15 45109315 missense probably damaging 0.99
R7272:Kcnv1 UTSW 15 45113180 missense probably benign 0.00
R7367:Kcnv1 UTSW 15 45109242 missense probably damaging 1.00
R7995:Kcnv1 UTSW 15 45109347 missense probably damaging 1.00
R8271:Kcnv1 UTSW 15 45109358 missense probably benign 0.00
X0026:Kcnv1 UTSW 15 45109467 missense possibly damaging 0.69
Z1177:Kcnv1 UTSW 15 45114435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGCTCCATGACATGC -3'
(R):5'- GGTCAGGATGGATCTGTCAC -3'

Sequencing Primer
(F):5'- TCCATGACATGCAGGCGAC -3'
(R):5'- TGGATCTGTCACCCCGCAAC -3'
Posted On2015-06-24