Mutagenetix > Incidental Mutations

Incidental Mutation 'R4335:Ston1'

323752

Institutional Source

Beutler Lab

Gene Symbol

Ston1

Ensembl Gene

ENSMUSG00000033855

Gene Name

stonin 1

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R4335 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88597684-88662586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88635697 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 177 (F177S)

Ref Sequence

ENSEMBL: ENSMUSP00000118522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064035
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: F177S

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	707	5.5e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112216

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132384

Predicted Effect

probably damaging
Transcript: ENSMUST00000137138
AA Change: F177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855
AA Change: F177S

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000150023
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: F177S

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	707	5.5e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153613

Predicted Effect

probably damaging
Transcript: ENSMUST00000163588
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: F177S

Domain	Start	End	E-Value	Type
low complexity region	50	65	N/A	INTRINSIC
low complexity region	132	143	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
Pfam:Adap_comp_sub	396	711	2.1e-64	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,544,370	L710P	probably damaging	Het
Abca9	G	A	11: 110,152,017	T402M	probably damaging	Het
Apbb1ip	G	A	2: 22,871,562		probably null	Het
Armh1	A	T	4: 117,214,463	I308N	probably damaging	Het
Ceacam5	G	A	7: 17,752,129	R517Q	probably benign	Het
Clic4	C	T	4: 135,218,605	S167N	probably benign	Het
Ehbp1l1	A	T	19: 5,708,769	L1644Q	probably damaging	Het
Erh	A	G	12: 80,642,841	L3P	probably benign	Het
Fam71d	T	C	12: 78,712,232	S109P	possibly damaging	Het
Fbxw7	T	C	3: 84,972,495	C375R	probably damaging	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fsd2	A	T	7: 81,542,065	S521R	probably damaging	Het
Hace1	A	G	10: 45,709,961	Y865C	probably damaging	Het
Iqcf1	G	A	9: 106,501,873	R62H	possibly damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Leng8	T	C	7: 4,147,038	Y781H	probably damaging	Het
Med8	G	T	4: 118,409,370		probably null	Het
Myo19	G	A	11: 84,908,288	A816T	probably benign	Het
Nat8f2	A	G	6: 85,868,251	L43P	probably damaging	Het
Omd	A	C	13: 49,590,236	D254A	probably benign	Het
Psd2	G	T	18: 36,007,530	A622S	probably damaging	Het
Rnf207	G	A	4: 152,315,605		probably benign	Het
Rsbn1l	T	C	5: 20,908,193	I444V	probably null	Het
Rxfp1	A	G	3: 79,686,798		probably null	Het
Selenot	C	A	3: 58,585,301	R70S	possibly damaging	Het
Sox6	A	G	7: 115,512,724	S557P	probably benign	Het
Sp9	G	A	2: 73,274,289	V396M	probably damaging	Het
Syne2	A	G	12: 76,028,092	E4602G	probably damaging	Het
Tbc1d19	A	G	5: 53,872,277	T327A	possibly damaging	Het
Tsga13	T	C	6: 30,900,045	D179G	probably damaging	Het
Wdr27	T	A	17: 14,920,756		probably null	Het

Other mutations in Ston1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Ston1	APN	17	88644443	missense	probably benign	0.00
IGL01593:Ston1	APN	17	88637010	missense	probably null	1.00
BB010:Ston1	UTSW	17	88636144	missense	probably benign	0.10
BB020:Ston1	UTSW	17	88636144	missense	probably benign	0.10
FR4449:Ston1	UTSW	17	88635525	missense	probably benign	0.38
R0610:Ston1	UTSW	17	88635281	missense	possibly damaging	0.49
R1421:Ston1	UTSW	17	88635793	missense	probably benign	0.02
R1620:Ston1	UTSW	17	88635816	missense	probably benign	0.01
R2002:Ston1	UTSW	17	88635529	missense	probably benign	0.01
R3108:Ston1	UTSW	17	88636155	nonsense	probably null
R3766:Ston1	UTSW	17	88635360	missense	probably damaging	1.00
R4222:Ston1	UTSW	17	88636771	missense	probably damaging	1.00
R4355:Ston1	UTSW	17	88637008	missense	probably damaging	1.00
R4867:Ston1	UTSW	17	88635694	missense	probably damaging	1.00
R4902:Ston1	UTSW	17	88645252	missense	probably damaging	0.99
R5084:Ston1	UTSW	17	88636574	missense	probably benign	0.00
R5434:Ston1	UTSW	17	88645311	utr 3 prime	probably benign
R5700:Ston1	UTSW	17	88644339	missense	probably damaging	1.00
R5858:Ston1	UTSW	17	88635631	missense	possibly damaging	0.93
R5863:Ston1	UTSW	17	88635945	missense	possibly damaging	0.64
R6458:Ston1	UTSW	17	88635303	missense	probably benign	0.14
R6459:Ston1	UTSW	17	88636468	missense	probably benign	0.16
R7012:Ston1	UTSW	17	88635985	missense	probably damaging	1.00
R7466:Ston1	UTSW	17	88635901	missense	probably benign	0.03
R7825:Ston1	UTSW	17	88636453	missense	possibly damaging	0.78
R7933:Ston1	UTSW	17	88636144	missense	probably benign	0.10
R8505:Ston1	UTSW	17	88635589	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GGACACATGTGCTTTATCCTATTCC -3'
(R):5'- GAGTGCAAGTGTTCCAGCTTC -3'

Sequencing Primer
(F):5'- CAGAGTGTTCTTCAAGCAGTGCC -3'
(R):5'- AGCTTCTCGCAGATGTAGTCCAG -3'

Posted On

2015-06-24