Incidental Mutation 'R4335:Ston1'
ID 323752
Institutional Source Beutler Lab
Gene Symbol Ston1
Ensembl Gene ENSMUSG00000033855
Gene Name stonin 1
Synonyms 4921524J06Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R4335 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 88905043-88955293 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88943125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 177 (F177S)
Ref Sequence ENSEMBL: ENSMUSP00000118522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]
AlphaFold Q8CDJ8
Predicted Effect probably damaging
Transcript: ENSMUST00000064035
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: F177S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132384
Predicted Effect probably damaging
Transcript: ENSMUST00000137138
AA Change: F177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855
AA Change: F177S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150023
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: F177S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153613
Predicted Effect probably damaging
Transcript: ENSMUST00000163588
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: F177S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 711 2.1e-64 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G A 11: 110,042,843 (GRCm39) T402M probably damaging Het
Apbb1ip G A 2: 22,761,574 (GRCm39) probably null Het
Armh1 A T 4: 117,071,660 (GRCm39) I308N probably damaging Het
Ceacam5 G A 7: 17,486,054 (GRCm39) R517Q probably benign Het
Clic4 C T 4: 134,945,916 (GRCm39) S167N probably benign Het
Ehbp1l1 A T 19: 5,758,797 (GRCm39) L1644Q probably damaging Het
Erh A G 12: 80,689,615 (GRCm39) L3P probably benign Het
Fbxw7 T C 3: 84,879,802 (GRCm39) C375R probably damaging Het
Fhdc1 C A 3: 84,352,133 (GRCm39) V1031F probably benign Het
Fsd2 A T 7: 81,191,813 (GRCm39) S521R probably damaging Het
Garin2 T C 12: 78,759,006 (GRCm39) S109P possibly damaging Het
Hace1 A G 10: 45,586,057 (GRCm39) Y865C probably damaging Het
Iqca1l A G 5: 24,749,368 (GRCm39) L710P probably damaging Het
Iqcf1 G A 9: 106,379,072 (GRCm39) R62H possibly damaging Het
Kcnv1 G A 15: 44,977,840 (GRCm39) T66M probably damaging Het
Leng8 T C 7: 4,150,037 (GRCm39) Y781H probably damaging Het
Med8 G T 4: 118,266,567 (GRCm39) probably null Het
Myo19 G A 11: 84,799,114 (GRCm39) A816T probably benign Het
Nat8f2 A G 6: 85,845,233 (GRCm39) L43P probably damaging Het
Omd A C 13: 49,743,712 (GRCm39) D254A probably benign Het
Psd2 G T 18: 36,140,583 (GRCm39) A622S probably damaging Het
Rnf207 G A 4: 152,400,062 (GRCm39) probably benign Het
Rsbn1l T C 5: 21,113,191 (GRCm39) I444V probably null Het
Rxfp1 A G 3: 79,594,105 (GRCm39) probably null Het
Selenot C A 3: 58,492,722 (GRCm39) R70S possibly damaging Het
Sox6 A G 7: 115,111,959 (GRCm39) S557P probably benign Het
Sp9 G A 2: 73,104,633 (GRCm39) V396M probably damaging Het
Syne2 A G 12: 76,074,866 (GRCm39) E4602G probably damaging Het
Tbc1d19 A G 5: 54,029,619 (GRCm39) T327A possibly damaging Het
Tsga13 T C 6: 30,876,980 (GRCm39) D179G probably damaging Het
Wdr27 T A 17: 15,141,018 (GRCm39) probably null Het
Other mutations in Ston1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ston1 APN 17 88,951,871 (GRCm39) missense probably benign 0.00
IGL01593:Ston1 APN 17 88,944,438 (GRCm39) missense probably null 1.00
BB010:Ston1 UTSW 17 88,943,572 (GRCm39) missense probably benign 0.10
BB020:Ston1 UTSW 17 88,943,572 (GRCm39) missense probably benign 0.10
FR4449:Ston1 UTSW 17 88,942,953 (GRCm39) missense probably benign 0.38
R0610:Ston1 UTSW 17 88,942,709 (GRCm39) missense possibly damaging 0.49
R1421:Ston1 UTSW 17 88,943,221 (GRCm39) missense probably benign 0.02
R1620:Ston1 UTSW 17 88,943,244 (GRCm39) missense probably benign 0.01
R2002:Ston1 UTSW 17 88,942,957 (GRCm39) missense probably benign 0.01
R3108:Ston1 UTSW 17 88,943,583 (GRCm39) nonsense probably null
R3766:Ston1 UTSW 17 88,942,788 (GRCm39) missense probably damaging 1.00
R4222:Ston1 UTSW 17 88,944,199 (GRCm39) missense probably damaging 1.00
R4355:Ston1 UTSW 17 88,944,436 (GRCm39) missense probably damaging 1.00
R4867:Ston1 UTSW 17 88,943,122 (GRCm39) missense probably damaging 1.00
R4902:Ston1 UTSW 17 88,952,680 (GRCm39) missense probably damaging 0.99
R5084:Ston1 UTSW 17 88,944,002 (GRCm39) missense probably benign 0.00
R5434:Ston1 UTSW 17 88,952,739 (GRCm39) utr 3 prime probably benign
R5700:Ston1 UTSW 17 88,951,767 (GRCm39) missense probably damaging 1.00
R5858:Ston1 UTSW 17 88,943,059 (GRCm39) missense possibly damaging 0.93
R5863:Ston1 UTSW 17 88,943,373 (GRCm39) missense possibly damaging 0.64
R6458:Ston1 UTSW 17 88,942,731 (GRCm39) missense probably benign 0.14
R6459:Ston1 UTSW 17 88,943,896 (GRCm39) missense probably benign 0.16
R7012:Ston1 UTSW 17 88,943,413 (GRCm39) missense probably damaging 1.00
R7466:Ston1 UTSW 17 88,943,329 (GRCm39) missense probably benign 0.03
R7825:Ston1 UTSW 17 88,943,881 (GRCm39) missense possibly damaging 0.78
R7933:Ston1 UTSW 17 88,943,572 (GRCm39) missense probably benign 0.10
R8505:Ston1 UTSW 17 88,943,017 (GRCm39) missense probably benign 0.35
R8876:Ston1 UTSW 17 88,942,600 (GRCm39) missense probably benign
R9050:Ston1 UTSW 17 88,944,228 (GRCm39) missense probably benign 0.00
R9429:Ston1 UTSW 17 88,943,034 (GRCm39) missense probably benign
R9798:Ston1 UTSW 17 88,944,472 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACACATGTGCTTTATCCTATTCC -3'
(R):5'- GAGTGCAAGTGTTCCAGCTTC -3'

Sequencing Primer
(F):5'- CAGAGTGTTCTTCAAGCAGTGCC -3'
(R):5'- AGCTTCTCGCAGATGTAGTCCAG -3'
Posted On 2015-06-24