Incidental Mutation 'R0004:Ccdc18'
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108161700 bp
Amino Acid Change Aspartic acid to Glycine at position 387 (D387G)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677] [ENSMUST00000197718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047677
AA Change: D387G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: D387G

coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195973
Predicted Effect probably benign
Transcript: ENSMUST00000197718
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531

coiled coil region 109 140 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108206617 nonsense probably null
R7506:Ccdc18 UTSW 5 108163739 missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108229049 critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108228662 missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108149041 critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108180833 missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108228645 nonsense probably null
R8019:Ccdc18 UTSW 5 108228645 nonsense probably null
R8172:Ccdc18 UTSW 5 108163774 critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108197795 missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108161503 missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108155797 missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108216033 missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108155797 missense probably damaging 1.00
RF013:Ccdc18 UTSW 5 108220716 missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cttttcccttttttgttgtgtcc -3'
Posted On2013-05-09