Incidental Mutation 'R4320:Asb13'
ID323787
Institutional Source Beutler Lab
Gene Symbol Asb13
Ensembl Gene ENSMUSG00000033781
Gene Nameankyrin repeat and SOCS box-containing 13
Synonyms6430573K02Rik, 2210015B19Rik
MMRRC Submission 041661-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4320 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3634032-3653822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3645012 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 160 (R160L)
Ref Sequence ENSEMBL: ENSMUSP00000046476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042288
AA Change: R160L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046476
Gene: ENSMUSG00000033781
AA Change: R160L

DomainStartEndE-ValueType
ANK 18 47 1.25e2 SMART
ANK 51 80 3.91e-3 SMART
ANK 84 113 1.53e-5 SMART
ANK 116 145 3.71e-4 SMART
ANK 149 178 6.65e-6 SMART
ANK 181 210 6.92e-4 SMART
SOCS_box 239 278 2.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157850
Meta Mutation Damage Score 0.1097 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,246 V826I possibly damaging Het
Arid4a T A 12: 71,069,995 I609N possibly damaging Het
Brix1 A T 15: 10,483,312 M91K probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdh10 A G 15: 18,985,165 D305G probably benign Het
Daxx T C 17: 33,911,419 L136P probably damaging Het
Fmo1 A T 1: 162,833,631 L361Q probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm5114 T G 7: 39,407,627 Y856S probably damaging Het
Grk5 C T 19: 61,091,945 R576* probably null Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Htr1f T C 16: 64,926,687 I81V possibly damaging Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Mtf2 T A 5: 108,087,025 C3S probably damaging Het
Mtmr3 T C 11: 4,487,947 R836G probably benign Het
Ntrk2 A G 13: 58,860,146 N241D possibly damaging Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr527 T A 7: 140,336,306 I148N possibly damaging Het
Olfr843 A C 9: 19,248,756 I214M probably damaging Het
Olfr846 G T 9: 19,360,958 Y132* probably null Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pax2 T A 19: 44,835,399 F366I probably damaging Het
Plekha5 A G 6: 140,543,817 K316E possibly damaging Het
Ppp4r4 T A 12: 103,598,243 N8K probably damaging Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Sostdc1 C A 12: 36,317,420 S198R probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Stat4 A G 1: 52,074,707 N192S probably benign Het
Thoc1 A G 18: 9,960,493 H66R probably benign Het
Tpr A G 1: 150,423,574 E1101G possibly damaging Het
Trpa1 G T 1: 14,874,452 H1023N probably benign Het
Tsen15 A T 1: 152,383,709 D66E probably damaging Het
Tssk3 A G 4: 129,489,201 V226A possibly damaging Het
Ufl1 T A 4: 25,278,601 probably null Het
Usp3 A G 9: 66,530,248 C258R possibly damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Other mutations in Asb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Asb13 APN 13 3643476 missense probably null 1.00
IGL00929:Asb13 APN 13 3649427 missense probably damaging 1.00
IGL01533:Asb13 APN 13 3642164 missense probably benign 0.05
R0654:Asb13 UTSW 13 3642092 missense probably damaging 1.00
R0694:Asb13 UTSW 13 3649480 missense probably benign 0.16
R0883:Asb13 UTSW 13 3645052 critical splice donor site probably null
R2014:Asb13 UTSW 13 3649512 critical splice donor site probably null
R2290:Asb13 UTSW 13 3649418 missense probably damaging 1.00
R4322:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4324:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4895:Asb13 UTSW 13 3643589 missense probably damaging 0.99
R5305:Asb13 UTSW 13 3643479 missense probably damaging 1.00
R6417:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6420:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6813:Asb13 UTSW 13 3645029 missense probably damaging 1.00
R7648:Asb13 UTSW 13 3649332 missense probably damaging 1.00
R7735:Asb13 UTSW 13 3634180 splice site probably null
R7771:Asb13 UTSW 13 3649463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTTCATCATGGCTACC -3'
(R):5'- TGCTGACGAACTGAGAAATGC -3'

Sequencing Primer
(F):5'- ATGGCTACCATTTCCAGTGTG -3'
(R):5'- TTTCCAGTTTCATAGACACAGAGGCC -3'
Posted On2015-06-24