Incidental Mutation 'R4320:Htr1f'
ID323792
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name5-hydroxytryptamine (serotonin) receptor 1F
SynonymsHtr1eb
MMRRC Submission 041661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4320 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location64924729-65105854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64926687 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 81 (I81V)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063076
AA Change: I81V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: I81V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,246 V826I possibly damaging Het
Arid4a T A 12: 71,069,995 I609N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Brix1 A T 15: 10,483,312 M91K probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdh10 A G 15: 18,985,165 D305G probably benign Het
Daxx T C 17: 33,911,419 L136P probably damaging Het
Fmo1 A T 1: 162,833,631 L361Q probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm5114 T G 7: 39,407,627 Y856S probably damaging Het
Grk5 C T 19: 61,091,945 R576* probably null Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Mtf2 T A 5: 108,087,025 C3S probably damaging Het
Mtmr3 T C 11: 4,487,947 R836G probably benign Het
Ntrk2 A G 13: 58,860,146 N241D possibly damaging Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr527 T A 7: 140,336,306 I148N possibly damaging Het
Olfr843 A C 9: 19,248,756 I214M probably damaging Het
Olfr846 G T 9: 19,360,958 Y132* probably null Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pax2 T A 19: 44,835,399 F366I probably damaging Het
Plekha5 A G 6: 140,543,817 K316E possibly damaging Het
Ppp4r4 T A 12: 103,598,243 N8K probably damaging Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Sostdc1 C A 12: 36,317,420 S198R probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Stat4 A G 1: 52,074,707 N192S probably benign Het
Thoc1 A G 18: 9,960,493 H66R probably benign Het
Tpr A G 1: 150,423,574 E1101G possibly damaging Het
Trpa1 G T 1: 14,874,452 H1023N probably benign Het
Tsen15 A T 1: 152,383,709 D66E probably damaging Het
Tssk3 A G 4: 129,489,201 V226A possibly damaging Het
Ufl1 T A 4: 25,278,601 probably null Het
Usp3 A G 9: 66,530,248 C258R possibly damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R0722:Htr1f UTSW 16 64925891 missense probably damaging 0.99
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R5037:Htr1f UTSW 16 64925928 missense probably damaging 1.00
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
R7864:Htr1f UTSW 16 64926794 missense probably damaging 1.00
R8677:Htr1f UTSW 16 64926051 missense possibly damaging 0.69
R8816:Htr1f UTSW 16 64926174 missense probably benign 0.05
R8836:Htr1f UTSW 16 64926833 missense probably benign
Z1176:Htr1f UTSW 16 64926077 nonsense probably null
Z1176:Htr1f UTSW 16 64926874 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGATCGTGATCATGATGCCG -3'
(R):5'- GAGGAACTGTTAAACCGAATGC -3'

Sequencing Primer
(F):5'- TGATCATGATGCCGGCATGC -3'
(R):5'- GAATGCCATCCAAAATTCTGGTATCC -3'
Posted On2015-06-24