Incidental Mutation 'R4321:Epha4'
ID323802
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
MMRRC Submission 041662-MU
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 77507213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000186930] [ENSMUST00000188797] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
Predicted Effect probably null
Transcript: ENSMUST00000027451
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186930
SMART Domains Protein: ENSMUSP00000140370
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 33 124 9.6e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188797
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188797
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188952
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189934
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Dthd1 A T 5: 62,818,690 I236F probably damaging Het
Egf A G 3: 129,706,134 C285R probably damaging Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Ice1 A T 13: 70,603,110 V1619E possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Lonp2 A G 8: 86,665,728 H474R probably damaging Het
Mark1 G T 1: 184,898,674 D746E possibly damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1755:Epha4 UTSW 1 77387823 missense probably damaging 1.00
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77426696 missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5648:Epha4 UTSW 1 77398525 missense probably benign 0.25
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R5829:Epha4 UTSW 1 77444994 missense probably benign 0.01
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6486:Epha4 UTSW 1 77383549 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7039:Epha4 UTSW 1 77506785 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
R7444:Epha4 UTSW 1 77387916 missense probably damaging 1.00
R7737:Epha4 UTSW 1 77381012 missense probably damaging 1.00
R7763:Epha4 UTSW 1 77390031 critical splice donor site probably null
R7950:Epha4 UTSW 1 77507196 missense probably damaging 0.99
R8297:Epha4 UTSW 1 77506910 missense probably damaging 1.00
R8373:Epha4 UTSW 1 77507079 missense possibly damaging 0.60
R8429:Epha4 UTSW 1 77390036 missense probably benign 0.08
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Z1176:Epha4 UTSW 1 77373733 makesense probably null
Z1176:Epha4 UTSW 1 77383011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTGCAGTCCCTTAGAGTG -3'
(R):5'- TCTGTTTCAGGCGGAAAAGTG -3'

Sequencing Primer
(F):5'- AGTGAACTTAATTTCAATGTACACCC -3'
(R):5'- GGATAACTGTCCTCAGAGTG -3'
Posted On2015-06-24