Incidental Mutation 'R4321:Mark1'
ID323805
Institutional Source Beutler Lab
Gene Symbol Mark1
Ensembl Gene ENSMUSG00000026620
Gene NameMAP/microtubule affinity regulating kinase 1
SynonymsEmk3, B930025N23Rik
MMRRC Submission 041662-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location184896789-184999570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 184898674 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 746 (D746E)
Ref Sequence ENSEMBL: ENSMUSP00000027929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027929
AA Change: D746E

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027929
Gene: ENSMUSG00000026620
AA Change: D746E

DomainStartEndE-ValueType
S_TKc 60 311 1.12e-108 SMART
low complexity region 316 328 N/A INTRINSIC
UBA 332 369 4.56e-9 SMART
low complexity region 376 386 N/A INTRINSIC
low complexity region 523 547 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
Pfam:KA1 751 795 4.5e-23 PFAM
Meta Mutation Damage Score 0.1174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Dthd1 A T 5: 62,818,690 I236F probably damaging Het
Egf A G 3: 129,706,134 C285R probably damaging Het
Epha4 T A 1: 77,507,213 probably null Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Ice1 A T 13: 70,603,110 V1619E possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Lonp2 A G 8: 86,665,728 H474R probably damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Mark1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mark1 APN 1 184898603 missense probably damaging 1.00
IGL00674:Mark1 APN 1 184912106 missense probably benign
IGL01903:Mark1 APN 1 184929380 splice site probably benign
IGL02004:Mark1 APN 1 184912589 missense possibly damaging 0.82
IGL03177:Mark1 APN 1 184944907 missense probably damaging 1.00
IGL03189:Mark1 APN 1 184919693 missense probably damaging 0.96
IGL03391:Mark1 APN 1 184919435 unclassified probably benign
R0277:Mark1 UTSW 1 184944952 missense possibly damaging 0.89
R0744:Mark1 UTSW 1 184921608 missense probably damaging 1.00
R0973:Mark1 UTSW 1 184921604 missense probably damaging 1.00
R1331:Mark1 UTSW 1 184928048 missense probably damaging 1.00
R2061:Mark1 UTSW 1 184928063 missense probably damaging 1.00
R2136:Mark1 UTSW 1 184919573 missense probably damaging 1.00
R2306:Mark1 UTSW 1 184900861 splice site probably benign
R3159:Mark1 UTSW 1 184908387 missense probably damaging 1.00
R3905:Mark1 UTSW 1 184908435 splice site probably null
R4512:Mark1 UTSW 1 184907089 missense probably benign 0.21
R4715:Mark1 UTSW 1 184912132 missense probably benign 0.00
R4829:Mark1 UTSW 1 184905527 missense possibly damaging 0.82
R5163:Mark1 UTSW 1 184905610 missense probably damaging 0.98
R5222:Mark1 UTSW 1 184928091 missense probably damaging 1.00
R5680:Mark1 UTSW 1 184944816 missense probably damaging 1.00
R6582:Mark1 UTSW 1 184912589 missense possibly damaging 0.82
R6943:Mark1 UTSW 1 184898787 missense probably damaging 1.00
R6979:Mark1 UTSW 1 184912628 missense possibly damaging 0.77
R7031:Mark1 UTSW 1 184912632 missense possibly damaging 0.82
R7455:Mark1 UTSW 1 184919750 missense probably damaging 0.99
R7470:Mark1 UTSW 1 184928044 nonsense probably null
R7715:Mark1 UTSW 1 184907234 missense probably damaging 0.98
R8193:Mark1 UTSW 1 184928052 missense probably damaging 0.99
R8474:Mark1 UTSW 1 184919586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTACTCAGGTGTGGTG -3'
(R):5'- CCTTGTAGAGGTTCATCGGGAG -3'

Sequencing Primer
(F):5'- ACTCAGGTGTGGTGCATCCTC -3'
(R):5'- TCCCAAAGAGAGAGACAAGGAC -3'
Posted On2015-06-24