Incidental Mutation 'R0004:Luc7l2'
ID32381
Institutional Source Beutler Lab
Gene Symbol Luc7l2
Ensembl Gene ENSMUSG00000029823
Gene NameLUC7-like 2 (S. cerevisiae)
Synonyms4930471C18Rik, CGI-59, CGI-74
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0004 (G1)
Quality Score201
Status Validated (trace)
Chromosome6
Chromosomal Location38551334-38609470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38589234 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 52 (K52M)
Ref Sequence ENSEMBL: ENSMUSP00000125394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057692] [ENSMUST00000159936] [ENSMUST00000160511] [ENSMUST00000161227] [ENSMUST00000161538] [ENSMUST00000162386] [ENSMUST00000163047]
Predicted Effect probably damaging
Transcript: ENSMUST00000057692
AA Change: K105M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055254
Gene: ENSMUSG00000029823
AA Change: K105M

DomainStartEndE-ValueType
Pfam:LUC7 5 257 6.5e-84 PFAM
low complexity region 269 341 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160430
SMART Domains Protein: ENSMUSP00000124686
Gene: ENSMUSG00000029823

DomainStartEndE-ValueType
Pfam:LUC7 1 211 9.9e-70 PFAM
low complexity region 217 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160582
Predicted Effect probably damaging
Transcript: ENSMUST00000161227
AA Change: K52M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125111
Gene: ENSMUSG00000029823
AA Change: K52M

DomainStartEndE-ValueType
Pfam:LUC7 1 288 6.9e-65 PFAM
low complexity region 294 317 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161538
AA Change: K105M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124010
Gene: ENSMUSG00000029823
AA Change: K105M

DomainStartEndE-ValueType
Pfam:LUC7 4 309 3.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162386
Predicted Effect probably damaging
Transcript: ENSMUST00000163047
AA Change: K52M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125394
Gene: ENSMUSG00000029823
AA Change: K52M

DomainStartEndE-ValueType
Pfam:LUC7 1 257 3.2e-66 PFAM
Meta Mutation Damage Score 0.5769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a C2H2-type zinc finger, coiled-coil region and arginine, serine-rich (RS) domain. A similar protein in mouse interacts with sodium channel modifier 1, and the encoded protein may be involved in the recognition of non-consensus splice donor sites in association with the U1 snRNP spliceosomal subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Luc7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Luc7l2 APN 6 38608170 unclassified probably benign
IGL00684:Luc7l2 APN 6 38608176 unclassified probably benign
IGL00785:Luc7l2 APN 6 38598786 missense possibly damaging 0.73
R0304:Luc7l2 UTSW 6 38592776 missense probably damaging 0.98
R1820:Luc7l2 UTSW 6 38598819 splice site probably null
R2223:Luc7l2 UTSW 6 38565724 intron probably benign
R3815:Luc7l2 UTSW 6 38570591 missense possibly damaging 0.83
R5016:Luc7l2 UTSW 6 38585101 missense possibly damaging 0.54
R7583:Luc7l2 UTSW 6 38551885 missense probably damaging 0.98
R7655:Luc7l2 UTSW 6 38603464 missense unknown
R7656:Luc7l2 UTSW 6 38603464 missense unknown
R7722:Luc7l2 UTSW 6 38603308 missense unknown
R7761:Luc7l2 UTSW 6 38555064 critical splice donor site probably null
Z1088:Luc7l2 UTSW 6 38603369 utr 3 prime probably benign
Z1176:Luc7l2 UTSW 6 38551908 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAATTAATCTCAGGGCTTCCTGTG -3'
(R):5'- ACATGCTTGACTGACAAATTCTGGGT -3'

Sequencing Primer
(F):5'- GTGTGATAGGAAAGCATTTCTTTACC -3'
(R):5'- agcacacagaggcaaagg -3'
Posted On2013-05-09