Incidental Mutation 'R4321:Egf'
ID323811
Institutional Source Beutler Lab
Gene Symbol Egf
Ensembl Gene ENSMUSG00000028017
Gene Nameepidermal growth factor
Synonyms
MMRRC Submission 041662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129677565-129755316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129706134 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 285 (C285R)
Ref Sequence ENSEMBL: ENSMUSP00000143075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029653] [ENSMUST00000197079] [ENSMUST00000197713] [ENSMUST00000199615]
Predicted Effect probably damaging
Transcript: ENSMUST00000029653
AA Change: C786R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029653
Gene: ENSMUSG00000028017
AA Change: C786R

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LY 74 115 1.81e-3 SMART
LY 116 157 4.16e-3 SMART
LY 158 199 6.86e-4 SMART
LY 200 244 1.06e-4 SMART
EGF_like 330 361 7.86e-1 SMART
EGF_CA 362 402 2.4e-8 SMART
EGF 406 443 8.65e-1 SMART
EGF 444 483 5.79e-2 SMART
LY 510 552 1.1e-7 SMART
LY 553 595 4.32e-10 SMART
LY 596 639 6.05e-14 SMART
LY 640 682 2.89e-11 SMART
LY 683 724 1.3e-4 SMART
EGF 750 787 6.21e-2 SMART
EGF 841 876 9.13e0 SMART
EGF_CA 877 918 5.92e-8 SMART
EGF_like 919 959 3.56e-4 SMART
EGF 981 1019 2.79e-4 SMART
transmembrane domain 1039 1061 N/A INTRINSIC
low complexity region 1080 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197079
AA Change: C285R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143075
Gene: ENSMUSG00000028017
AA Change: C285R

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF_like 418 458 1.7e-6 SMART
EGF 480 518 1.3e-6 SMART
transmembrane domain 538 560 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197713
SMART Domains Protein: ENSMUSP00000143108
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199615
AA Change: C285R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142497
Gene: ENSMUSG00000028017
AA Change: C285R

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF 439 477 1.3e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 538 557 N/A INTRINSIC
Meta Mutation Damage Score 0.9646 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: This gene encodes epidermal growth factor (EGF), the founding member of the EGF family of growth factors that are implicated in cell proliferation and differentiation. The encoded protein can localize to the membrane and function in juxtacrine signaling or undergo proteolytic processing to generate a soluble form of the hormone. Mice lacking the encoded protein do not exhibit an abnormal phenotype but transgenic mice overexpressing the encoded protein exhibit hypospermatogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants have normal phenotype. Females triply null, for this locus and the amphiregulin and transforming growth factor alpha genes, are unable to nurse due to impaired mammary gland development and show mild integument and digestive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Dthd1 A T 5: 62,818,690 I236F probably damaging Het
Epha4 T A 1: 77,507,213 probably null Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Ice1 A T 13: 70,603,110 V1619E possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Lonp2 A G 8: 86,665,728 H474R probably damaging Het
Mark1 G T 1: 184,898,674 D746E possibly damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Egf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Egf APN 3 129711449 missense probably benign 0.01
IGL00579:Egf APN 3 129697798 missense probably benign 0.36
IGL01307:Egf APN 3 129739993 missense probably damaging 0.99
IGL01314:Egf APN 3 129686260 missense probably benign 0.16
IGL01360:Egf APN 3 129740020 missense probably damaging 1.00
IGL01367:Egf APN 3 129702455 critical splice donor site probably null
IGL01610:Egf APN 3 129706260 splice site probably benign
IGL01721:Egf APN 3 129697722 nonsense probably null
IGL01803:Egf APN 3 129736766 missense probably benign 0.09
IGL01866:Egf APN 3 129735880 missense probably benign 0.03
IGL02001:Egf APN 3 129716768 missense probably damaging 1.00
IGL02141:Egf APN 3 129739982 nonsense probably null
IGL02209:Egf APN 3 129707307 missense possibly damaging 0.93
IGL02347:Egf APN 3 129678377 missense probably benign 0.17
IGL02821:Egf APN 3 129702479 missense probably damaging 1.00
IGL02902:Egf APN 3 129681147 missense probably benign 0.34
IGL03114:Egf APN 3 129736880 missense probably damaging 0.98
PIT4151001:Egf UTSW 3 129702549 missense probably benign 0.00
R0200:Egf UTSW 3 129706233 missense probably benign 0.00
R0200:Egf UTSW 3 129737549 missense probably damaging 1.00
R0463:Egf UTSW 3 129706233 missense probably benign 0.00
R0463:Egf UTSW 3 129737549 missense probably damaging 1.00
R0507:Egf UTSW 3 129681179 missense possibly damaging 0.62
R0801:Egf UTSW 3 129702585 splice site probably benign
R1495:Egf UTSW 3 129713006 missense probably damaging 1.00
R1535:Egf UTSW 3 129690778 missense probably benign 0.00
R1626:Egf UTSW 3 129686215 missense possibly damaging 0.55
R1702:Egf UTSW 3 129690811 missense probably benign 0.17
R1906:Egf UTSW 3 129725224 missense probably benign 0.01
R2184:Egf UTSW 3 129723358 nonsense probably null
R3842:Egf UTSW 3 129697793 nonsense probably null
R3918:Egf UTSW 3 129696860 missense probably null 0.22
R4073:Egf UTSW 3 129735969 missense probably benign 0.01
R4074:Egf UTSW 3 129735969 missense probably benign 0.01
R4075:Egf UTSW 3 129735969 missense probably benign 0.01
R4307:Egf UTSW 3 129719095 missense probably damaging 0.99
R4617:Egf UTSW 3 129690793 missense probably benign 0.02
R4646:Egf UTSW 3 129720276 missense probably damaging 1.00
R4674:Egf UTSW 3 129718040 missense probably damaging 1.00
R4798:Egf UTSW 3 129716678 missense probably damaging 1.00
R4931:Egf UTSW 3 129711468 missense probably damaging 1.00
R4992:Egf UTSW 3 129711530 splice site probably null
R5166:Egf UTSW 3 129735840 missense probably benign
R5179:Egf UTSW 3 129686287 missense probably damaging 0.99
R5230:Egf UTSW 3 129718024 missense possibly damaging 0.95
R6043:Egf UTSW 3 129736785 missense probably benign 0.09
R6119:Egf UTSW 3 129736772 missense probably benign 0.00
R6493:Egf UTSW 3 129719088 start gained probably benign
R6639:Egf UTSW 3 129736832 missense probably benign 0.22
R6936:Egf UTSW 3 129681204 missense possibly damaging 0.95
R7019:Egf UTSW 3 129718064 splice site probably null
R7046:Egf UTSW 3 129754958 missense unknown
R7463:Egf UTSW 3 129740015 missense probably benign 0.39
R7472:Egf UTSW 3 129686263 missense possibly damaging 0.53
R7723:Egf UTSW 3 129706137 missense probably benign 0.00
R7920:Egf UTSW 3 129735840 missense probably benign
R7952:Egf UTSW 3 129739996 missense probably damaging 1.00
R8098:Egf UTSW 3 129690837 missense probably benign 0.09
R8344:Egf UTSW 3 129754943 missense unknown
X0011:Egf UTSW 3 129711298 missense probably benign 0.19
Z1176:Egf UTSW 3 129697717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGAACTCAGATTGTGGTAAGGAAC -3'
(R):5'- GCATCAGCAACATCCTTGAC -3'

Sequencing Primer
(F):5'- TCTCACAGGGGAGGGGTAC -3'
(R):5'- GCAACATCCTTGACCTCTCCAG -3'
Posted On2015-06-24