Incidental Mutation 'R4321:Dthd1'
ID323818
Institutional Source Beutler Lab
Gene Symbol Dthd1
Ensembl Gene ENSMUSG00000090326
Gene Namedeath domain containing 1
SynonymsGm17384
MMRRC Submission 041662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location62813823-62888308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62818690 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 236 (I236F)
Ref Sequence ENSEMBL: ENSMUSP00000131534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170704]
Predicted Effect probably damaging
Transcript: ENSMUST00000170704
AA Change: I236F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326
AA Change: I236F

DomainStartEndE-ValueType
Pfam:Death 693 778 4.2e-12 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Egf A G 3: 129,706,134 C285R probably damaging Het
Epha4 T A 1: 77,507,213 probably null Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Ice1 A T 13: 70,603,110 V1619E possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Lonp2 A G 8: 86,665,728 H474R probably damaging Het
Mark1 G T 1: 184,898,674 D746E possibly damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Dthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4342:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4589:Dthd1 UTSW 5 62843026 frame shift probably null
FR4976:Dthd1 UTSW 5 62843024 small insertion probably benign
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0395:Dthd1 UTSW 5 62814333 missense possibly damaging 0.71
R0734:Dthd1 UTSW 5 62839410 splice site probably benign
R0899:Dthd1 UTSW 5 62842928 missense probably benign 0.01
R0970:Dthd1 UTSW 5 62887981 missense probably damaging 1.00
R1104:Dthd1 UTSW 5 62821959 missense probably damaging 1.00
R1518:Dthd1 UTSW 5 62822040 missense probably damaging 1.00
R1831:Dthd1 UTSW 5 62827229 missense probably benign 0.02
R2110:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2110:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2112:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2112:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2248:Dthd1 UTSW 5 62849900 missense probably damaging 0.99
R2311:Dthd1 UTSW 5 62839237 splice site probably benign
R2937:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R2938:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R3835:Dthd1 UTSW 5 62849785 missense probably damaging 1.00
R3855:Dthd1 UTSW 5 62827129 missense probably benign 0.21
R3855:Dthd1 UTSW 5 62888023 missense probably benign 0.00
R4049:Dthd1 UTSW 5 62827165 nonsense probably null
R4353:Dthd1 UTSW 5 62842867 missense probably benign 0.04
R4560:Dthd1 UTSW 5 62827092 missense probably damaging 1.00
R4613:Dthd1 UTSW 5 62827068 missense probably damaging 1.00
R4689:Dthd1 UTSW 5 62842912 missense probably damaging 0.99
R4715:Dthd1 UTSW 5 62888187 missense probably benign
R4718:Dthd1 UTSW 5 62818793 missense probably damaging 1.00
R4967:Dthd1 UTSW 5 62888206 missense probably benign 0.01
R5068:Dthd1 UTSW 5 62818716 missense probably benign
R5089:Dthd1 UTSW 5 62849905 missense probably benign
R5355:Dthd1 UTSW 5 62839387 missense probably damaging 1.00
R5470:Dthd1 UTSW 5 62818766 missense probably damaging 1.00
R6284:Dthd1 UTSW 5 62814041 missense possibly damaging 0.71
R6293:Dthd1 UTSW 5 62842850 missense probably damaging 0.99
R6484:Dthd1 UTSW 5 62814332 missense probably benign 0.34
R6516:Dthd1 UTSW 5 62839264 missense probably benign 0.16
R6741:Dthd1 UTSW 5 62842946 missense probably damaging 1.00
R6810:Dthd1 UTSW 5 62814329 missense probably benign 0.01
R7565:Dthd1 UTSW 5 62843092 missense probably damaging 1.00
R7595:Dthd1 UTSW 5 62818715 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGTTAGAAAATGAGGTTGAGACTCC -3'
(R):5'- GCCCAGGCTTTACTAACCTTAC -3'

Sequencing Primer
(F):5'- GACCCTCAAGTCTCTTGT -3'
(R):5'- AGGCTTTACTAACCTTACAACTTCC -3'
Posted On2015-06-24