Incidental Mutation 'R4321:Gm15448'
ID323825
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission 041662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3822755 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000104260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably benign
Transcript: ENSMUST00000094911
AA Change: S372P

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108619
AA Change: S372P
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108620
AA Change: S372P

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153846
AA Change: S372P
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189095
AA Change: S372P

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: S372P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Dthd1 A T 5: 62,818,690 I236F probably damaging Het
Egf A G 3: 129,706,134 C285R probably damaging Het
Epha4 T A 1: 77,507,213 probably null Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Ice1 A T 13: 70,603,110 V1619E possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Lonp2 A G 8: 86,665,728 H474R probably damaging Het
Mark1 G T 1: 184,898,674 D746E possibly damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
Predicted Primers PCR Primer
(F):5'- GGGCCTCAGAAAATGTTTGG -3'
(R):5'- CCCAAGAGAACACTGGGATG -3'

Sequencing Primer
(F):5'- TTGGAGAATGATAGTGGGGACTTACC -3'
(R):5'- ATGTAAGAGACGACCTCCTTCTC -3'
Posted On2015-06-24