Incidental Mutation 'R0004:Cd207'
ID32383
Institutional Source Beutler Lab
Gene Symbol Cd207
Ensembl Gene ENSMUSG00000034783
Gene NameCD207 antigen
SynonymsLangerin
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0004 (G1)
Quality Score164
Status Validated (trace)
Chromosome6
Chromosomal Location83671215-83677857 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 83674248 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 242 (Q242*)
Ref Sequence ENSEMBL: ENSMUSP00000040746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037882]
Predicted Effect probably null
Transcript: ENSMUST00000037882
AA Change: Q242*
SMART Domains Protein: ENSMUSP00000040746
Gene: ENSMUSG00000034783
AA Change: Q242*

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
CLECT 198 323 9.42e-30 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed only in Langerhans cells which are immature dendritic cells of the epidermis and mucosa. It is localized in the Birbeck granules, organelles present in the cytoplasm of Langerhans cells and consisting of superimposed and zippered membranes. It is a C-type lectin with mannose binding specificity, and it has been proposed that mannose binding by this protein leads to internalization of antigen into Birbeck granules and providing access to a nonclassical antigen-processing pathway. Mutations in this gene result in Birbeck granules deficiency or loss of sugar binding activity. [provided by RefSeq, Aug 2010]
PHENOTYPE: Nullizygous mice lack Birbeck granules with no marked loss of Langerhans cell (LC) function. Knock-in mice expressing diphtheria toxin (DT) receptors show LC depletion. Heterozygotes for a knock-in allele show DT-induced LC ablation, altered contact hypersensitivity and susceptibility to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Cd207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cd207 APN 6 83675926 missense possibly damaging 0.95
IGL01101:Cd207 APN 6 83675857 missense probably benign 0.25
IGL02504:Cd207 APN 6 83677806 utr 5 prime probably benign
IGL03309:Cd207 APN 6 83677753 missense possibly damaging 0.82
R0646:Cd207 UTSW 6 83675756 missense probably benign 0.00
R1709:Cd207 UTSW 6 83672836 missense possibly damaging 0.92
R1756:Cd207 UTSW 6 83675597 missense probably benign
R1867:Cd207 UTSW 6 83675653 missense probably damaging 0.99
R1868:Cd207 UTSW 6 83671701 nonsense probably null
R1955:Cd207 UTSW 6 83671775 missense probably benign 0.42
R5005:Cd207 UTSW 6 83674385 missense possibly damaging 0.95
R5024:Cd207 UTSW 6 83674319 missense probably damaging 1.00
R6430:Cd207 UTSW 6 83675887 missense probably benign 0.06
R7401:Cd207 UTSW 6 83677848 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCCATTAGGCAGTACTTGGGAAACG -3'
(R):5'- TCCTGACACTGGGAACTCAAGGAC -3'

Sequencing Primer
(F):5'- CATATGCACTGAAACcacacac -3'
(R):5'- TGGAGCCTGGACTCATTCAC -3'
Posted On2013-05-09