Incidental Mutation 'R4321:Ice1'
ID323845
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission 041662-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70603110 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1619 (V1619E)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: V1619E

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: V1619E

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Dthd1 A T 5: 62,818,690 I236F probably damaging Het
Egf A G 3: 129,706,134 C285R probably damaging Het
Epha4 T A 1: 77,507,213 probably null Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Lonp2 A G 8: 86,665,728 H474R probably damaging Het
Mark1 G T 1: 184,898,674 D746E possibly damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAACGGAGAGGACACTATC -3'
(R):5'- AATGAAGTCCCTCAGCCAGC -3'

Sequencing Primer
(F):5'- GGACACTATCCTTCCACTAGCTG -3'
(R):5'- CCAGCCTCAGGGGAAGGAAC -3'
Posted On2015-06-24