Mutagenetix > Incidental Mutations

Incidental Mutation 'R4321:Spef2'

323846

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

041662-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R4321 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9679343 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 636 (I636K)

Ref Sequence

ENSEMBL: ENSMUSP00000146967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000160236] [ENSMUST00000208854]

Predicted Effect

probably benign
Transcript: ENSMUST00000041840
AA Change: I636K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: I636K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160236
AA Change: I636K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: I636K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: I636K

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (56/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	A	T	10: 29,224,891	D420V	probably damaging	Het
AI464131	C	T	4: 41,498,767	V288I	probably benign	Het
Als2	A	C	1: 59,167,454		probably benign	Het
Ankrd9	A	G	12: 110,976,640	L287P	probably damaging	Het
Bbof1	A	T	12: 84,427,128	R411*	probably null	Het
Camta2	A	T	11: 70,678,325	L598Q	probably damaging	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Cep85	G	A	4: 134,132,285	T689I	probably damaging	Het
Clvs1	T	C	4: 9,282,029		probably benign	Het
Cpped1	T	C	16: 11,887,746	T65A	probably benign	Het
Daxx	T	C	17: 33,911,406	Y132H	possibly damaging	Het
Dock7	T	C	4: 99,072,454	E279G	probably damaging	Het
Dok7	A	T	5: 35,079,797		probably benign	Het
Doxl2	T	A	6: 48,976,522	D460E	probably damaging	Het
Dthd1	A	T	5: 62,818,690	I236F	probably damaging	Het
Egf	A	G	3: 129,706,134	C285R	probably damaging	Het
Epha4	T	A	1: 77,507,213		probably null	Het
Fbxw13	A	C	9: 109,181,435	I378M	probably benign	Het
Gaa	A	T	11: 119,270,137	N2I	probably benign	Het
Gad1	G	A	2: 70,589,830	D353N	probably damaging	Het
Ggcx	A	G	6: 72,428,820	S545G	probably benign	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Gm2663	G	T	6: 40,997,596	Q87K	probably damaging	Het
Golga4	A	G	9: 118,556,435	E847G	probably damaging	Het
Hipk3	C	A	2: 104,446,571	V388L	probably damaging	Het
Ibtk	T	C	9: 85,735,072	D149G	possibly damaging	Het
Ice1	A	T	13: 70,603,110	V1619E	possibly damaging	Het
Itpr3	A	G	17: 27,111,974	E1752G	probably benign	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Kprp	G	A	3: 92,824,856	R296W	probably damaging	Het
Lama1	G	A	17: 67,771,083	G1171D	probably benign	Het
Lonp2	A	G	8: 86,665,728	H474R	probably damaging	Het
Mark1	G	T	1: 184,898,674	D746E	possibly damaging	Het
Mlxipl	C	T	5: 135,135,450	Q167*	probably null	Het
Myo3a	A	T	2: 22,267,155	N162Y	probably damaging	Het
Myo5a	T	G	9: 75,217,530	V1787G	probably damaging	Het
Nrxn3	A	T	12: 90,199,231	E227V	probably damaging	Het
Orc1	G	A	4: 108,588,776	M30I	probably benign	Het
Rufy2	A	G	10: 62,982,680	D5G	probably damaging	Het
Rufy4	A	T	1: 74,132,784	D222V	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sept1	G	A	7: 127,217,028	P77S	probably damaging	Het
Slamf1	T	C	1: 171,775,126		probably null	Het
Sox6	A	G	7: 115,580,563		probably null	Het
Tshz2	T	A	2: 169,885,545	I218N	possibly damaging	Het
Txnl1	T	C	18: 63,679,490	T78A	possibly damaging	Het
Ulk4	T	G	9: 121,073,996	R1138S	probably benign	Het
Vamp8	A	C	6: 72,385,553	V88G	possibly damaging	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Zfp850	A	C	7: 27,989,400	F461C	probably damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAGCTACTCTCACAATTCCGTGC -3'
(R):5'- CAGACCCTTGAATGTGTCCC -3'

Sequencing Primer
(F):5'- GTGCACACTCTCACAATTACATG -3'
(R):5'- TGAATGTGTCCCTGACTCCAGAAG -3'

Posted On

2015-06-24