Mutagenetix > Incidental Mutations

Incidental Mutation 'R4321:Lama1'

323851

Institutional Source

Beutler Lab

Gene Symbol

Lama1

Ensembl Gene

ENSMUSG00000032796

Gene Name

laminin, alpha 1

Synonyms

Lama

MMRRC Submission

041662-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4321 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67697265-67822645 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 67771083 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1171 (G1171D)

Ref Sequence

ENSEMBL: ENSMUSP00000043957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035471]

Predicted Effect

probably benign
Transcript: ENSMUST00000035471
AA Change: G1171D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: G1171D

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
LamNT	23	275	1.2e-131	SMART
EGF_Lam	277	331	1e-5	SMART
EGF_Lam	334	401	6.6e-6	SMART
EGF_Lam	404	458	9.11e-9	SMART
EGF_Lam	461	507	8.12e-6	SMART
LamB	570	702	2.09e-57	SMART
EGF_like	715	746	3.36e0	SMART
EGF_Lam	749	795	7.01e-10	SMART
EGF_Lam	798	853	3.59e-7	SMART
EGF_Lam	856	906	1.53e-10	SMART
EGF_Lam	909	955	1.13e-13	SMART
EGF_Lam	958	1002	1.36e-7	SMART
EGF_Lam	1005	1048	7.29e-8	SMART
EGF_like	1034	1082	4.83e1	SMART
EGF_Lam	1051	1094	1.67e-7	SMART
EGF_Lam	1097	1154	1.32e-5	SMART
LamB	1220	1352	8.7e-46	SMART
Pfam:Laminin_EGF	1367	1397	1.7e-6	PFAM
EGF_Lam	1410	1456	7.12e-11	SMART
EGF_Lam	1459	1513	3.25e-5	SMART
EGF_like	1497	1547	6.41e1	SMART
EGF_Lam	1516	1560	1.71e-13	SMART
Pfam:Laminin_I	1574	1838	1.7e-91	PFAM
low complexity region	2012	2031	N/A	INTRINSIC
low complexity region	2087	2098	N/A	INTRINSIC
LamG	2145	2287	3.66e-30	SMART
LamG	2332	2473	5.98e-35	SMART
LamG	2513	2661	1.11e-29	SMART
low complexity region	2695	2708	N/A	INTRINSIC
LamG	2743	2877	9.72e-35	SMART
LamG	2920	3056	4.63e-41	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	A	T	10: 29,224,891	D420V	probably damaging	Het
AI464131	C	T	4: 41,498,767	V288I	probably benign	Het
Als2	A	C	1: 59,167,454		probably benign	Het
Ankrd9	A	G	12: 110,976,640	L287P	probably damaging	Het
Bbof1	A	T	12: 84,427,128	R411*	probably null	Het
Camta2	A	T	11: 70,678,325	L598Q	probably damaging	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Cep85	G	A	4: 134,132,285	T689I	probably damaging	Het
Clvs1	T	C	4: 9,282,029		probably benign	Het
Cpped1	T	C	16: 11,887,746	T65A	probably benign	Het
Daxx	T	C	17: 33,911,406	Y132H	possibly damaging	Het
Dock7	T	C	4: 99,072,454	E279G	probably damaging	Het
Dok7	A	T	5: 35,079,797		probably benign	Het
Doxl2	T	A	6: 48,976,522	D460E	probably damaging	Het
Dthd1	A	T	5: 62,818,690	I236F	probably damaging	Het
Egf	A	G	3: 129,706,134	C285R	probably damaging	Het
Epha4	T	A	1: 77,507,213		probably null	Het
Fbxw13	A	C	9: 109,181,435	I378M	probably benign	Het
Gaa	A	T	11: 119,270,137	N2I	probably benign	Het
Gad1	G	A	2: 70,589,830	D353N	probably damaging	Het
Ggcx	A	G	6: 72,428,820	S545G	probably benign	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Gm2663	G	T	6: 40,997,596	Q87K	probably damaging	Het
Golga4	A	G	9: 118,556,435	E847G	probably damaging	Het
Hipk3	C	A	2: 104,446,571	V388L	probably damaging	Het
Ibtk	T	C	9: 85,735,072	D149G	possibly damaging	Het
Ice1	A	T	13: 70,603,110	V1619E	possibly damaging	Het
Itpr3	A	G	17: 27,111,974	E1752G	probably benign	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Kprp	G	A	3: 92,824,856	R296W	probably damaging	Het
Lonp2	A	G	8: 86,665,728	H474R	probably damaging	Het
Mark1	G	T	1: 184,898,674	D746E	possibly damaging	Het
Mlxipl	C	T	5: 135,135,450	Q167*	probably null	Het
Myo3a	A	T	2: 22,267,155	N162Y	probably damaging	Het
Myo5a	T	G	9: 75,217,530	V1787G	probably damaging	Het
Nrxn3	A	T	12: 90,199,231	E227V	probably damaging	Het
Orc1	G	A	4: 108,588,776	M30I	probably benign	Het
Rufy2	A	G	10: 62,982,680	D5G	probably damaging	Het
Rufy4	A	T	1: 74,132,784	D222V	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sept1	G	A	7: 127,217,028	P77S	probably damaging	Het
Slamf1	T	C	1: 171,775,126		probably null	Het
Sox6	A	G	7: 115,580,563		probably null	Het
Spef2	A	T	15: 9,679,343	I636K	possibly damaging	Het
Tshz2	T	A	2: 169,885,545	I218N	possibly damaging	Het
Txnl1	T	C	18: 63,679,490	T78A	possibly damaging	Het
Ulk4	T	G	9: 121,073,996	R1138S	probably benign	Het
Vamp8	A	C	6: 72,385,553	V88G	possibly damaging	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Zfp850	A	C	7: 27,989,400	F461C	probably damaging	Het

Other mutations in Lama1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Lama1	APN	17	67815928	missense	probably benign
IGL00336:Lama1	APN	17	67813948	missense	probably benign	0.07
IGL01066:Lama1	APN	17	67743326	missense	probably damaging	1.00
IGL01140:Lama1	APN	17	67802933	missense	probably benign	0.14
IGL01291:Lama1	APN	17	67738870	missense	probably damaging	1.00
IGL01296:Lama1	APN	17	67745051	missense	probably benign	0.27
IGL01317:Lama1	APN	17	67818701	missense	probably damaging	1.00
IGL01490:Lama1	APN	17	67750584	missense	possibly damaging	0.54
IGL01506:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01508:Lama1	APN	17	67809361	splice site	probably benign
IGL01522:Lama1	APN	17	67752774	splice site	probably benign
IGL01530:Lama1	APN	17	67796790	missense	probably benign	0.02
IGL01541:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01677:Lama1	APN	17	67779148	missense	probably benign	0.15
IGL01886:Lama1	APN	17	67807797	missense	probably benign	0.36
IGL01994:Lama1	APN	17	67752439	missense	probably benign	0.05
IGL02017:Lama1	APN	17	67764725	missense	probably benign	0.00
IGL02021:Lama1	APN	17	67821626	missense	probably damaging	1.00
IGL02026:Lama1	APN	17	67809292	missense	possibly damaging	0.82
IGL02044:Lama1	APN	17	67811490	missense	probably benign	0.01
IGL02120:Lama1	APN	17	67716789	missense	probably damaging	1.00
IGL02425:Lama1	APN	17	67811485	missense	probably benign	0.45
IGL02549:Lama1	APN	17	67790835	missense	possibly damaging	0.93
IGL02642:Lama1	APN	17	67812366	missense	probably benign	0.00
IGL02795:Lama1	APN	17	67738894	splice site	probably null
IGL02798:Lama1	APN	17	67795191	splice site	probably benign
IGL02863:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02870:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02876:Lama1	APN	17	67750692	critical splice donor site	probably null
IGL02885:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02891:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02978:Lama1	APN	17	67786081	nonsense	probably null
IGL03064:Lama1	APN	17	67779104	missense	probably benign	0.01
IGL03076:Lama1	APN	17	67716799	missense	possibly damaging	0.95
IGL03110:Lama1	APN	17	67798986	missense	probably benign	0.04
IGL03143:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03159:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03268:Lama1	APN	17	67804536	missense	probably damaging	0.99
ANU05:Lama1	UTSW	17	67738870	missense	probably damaging	1.00
PIT4472001:Lama1	UTSW	17	67764704	missense
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0050:Lama1	UTSW	17	67782056	missense	possibly damaging	0.66
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0111:Lama1	UTSW	17	67737498	missense	probably damaging	0.98
R0116:Lama1	UTSW	17	67776923	missense	probably benign	0.10
R0121:Lama1	UTSW	17	67798513	splice site	probably benign
R0278:Lama1	UTSW	17	67810183	missense	probably null	0.98
R0281:Lama1	UTSW	17	67817569	missense	probably damaging	1.00
R0312:Lama1	UTSW	17	67775851	missense	possibly damaging	0.45
R0419:Lama1	UTSW	17	67791610	critical splice donor site	probably null
R0512:Lama1	UTSW	17	67779134	missense	possibly damaging	0.67
R0514:Lama1	UTSW	17	67764698	missense	probably benign	0.40
R0562:Lama1	UTSW	17	67815959	missense	probably damaging	1.00
R0632:Lama1	UTSW	17	67752368	splice site	probably benign
R0645:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R0712:Lama1	UTSW	17	67779042	splice site	probably null
R0763:Lama1	UTSW	17	67772818	missense	probably damaging	0.97
R0941:Lama1	UTSW	17	67775865	missense	probably benign	0.10
R1025:Lama1	UTSW	17	67752898	missense	probably benign	0.00
R1084:Lama1	UTSW	17	67804469	missense	probably benign	0.12
R1103:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1420:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1430:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R1569:Lama1	UTSW	17	67780618	splice site	probably null
R1575:Lama1	UTSW	17	67810409	missense	possibly damaging	0.96
R1613:Lama1	UTSW	17	67807923	missense	probably benign	0.42
R1620:Lama1	UTSW	17	67767033	missense	probably benign	0.01
R1629:Lama1	UTSW	17	67805428	missense	probably benign	0.00
R1645:Lama1	UTSW	17	67737682	missense	probably benign	0.14
R1652:Lama1	UTSW	17	67807846	missense	probably damaging	0.97
R1674:Lama1	UTSW	17	67791244	missense	probably benign
R1678:Lama1	UTSW	17	67810155	missense	possibly damaging	0.56
R1710:Lama1	UTSW	17	67753791	missense	probably benign	0.00
R1712:Lama1	UTSW	17	67717186	missense	possibly damaging	0.95
R1737:Lama1	UTSW	17	67802921	missense	probably benign	0.36
R1757:Lama1	UTSW	17	67763836	missense	probably benign	0.40
R1757:Lama1	UTSW	17	67697383	missense	unknown
R1813:Lama1	UTSW	17	67791223	missense	probably benign
R1896:Lama1	UTSW	17	67791223	missense	probably benign
R1945:Lama1	UTSW	17	67745853	missense	probably benign	0.14
R2086:Lama1	UTSW	17	67817623	missense	probably damaging	1.00
R2149:Lama1	UTSW	17	67773865	missense	possibly damaging	0.95
R2178:Lama1	UTSW	17	67769515	missense	probably benign	0.07
R2183:Lama1	UTSW	17	67791009	missense	probably damaging	0.98
R2197:Lama1	UTSW	17	67752941	missense	probably benign	0.02
R2213:Lama1	UTSW	17	67777034	nonsense	probably null
R2260:Lama1	UTSW	17	67737507	missense	probably damaging	0.96
R2356:Lama1	UTSW	17	67810114	missense	probably damaging	1.00
R2420:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2421:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2422:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2424:Lama1	UTSW	17	67798665	missense	probably benign	0.09
R2442:Lama1	UTSW	17	67768317	missense	probably benign	0.04
R3147:Lama1	UTSW	17	67737658	missense	probably damaging	0.98
R3414:Lama1	UTSW	17	67737603	missense	probably damaging	1.00
R3683:Lama1	UTSW	17	67768333	missense	probably benign	0.40
R3820:Lama1	UTSW	17	67779046	splice site	probably null
R3821:Lama1	UTSW	17	67779046	splice site	probably null
R3822:Lama1	UTSW	17	67779046	splice site	probably null
R4012:Lama1	UTSW	17	67812373	nonsense	probably null
R4113:Lama1	UTSW	17	67764703	missense	probably benign	0.01
R4133:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R4133:Lama1	UTSW	17	67812486	missense	probably damaging	1.00
R4259:Lama1	UTSW	17	67752418	missense	possibly damaging	0.95
R4278:Lama1	UTSW	17	67791517	missense	probably null	0.00
R4374:Lama1	UTSW	17	67804518	missense	probably benign	0.00
R4386:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R4463:Lama1	UTSW	17	67761700	missense	probably damaging	1.00
R4629:Lama1	UTSW	17	67805360	critical splice acceptor site	probably null
R4630:Lama1	UTSW	17	67794300	missense	probably benign	0.00
R4633:Lama1	UTSW	17	67798584	missense	probably damaging	0.96
R4668:Lama1	UTSW	17	67752434	missense	probably benign	0.27
R4684:Lama1	UTSW	17	67773778	missense	possibly damaging	0.88
R4745:Lama1	UTSW	17	67738780	missense	probably damaging	1.00
R4786:Lama1	UTSW	17	67773859	missense	possibly damaging	0.77
R4797:Lama1	UTSW	17	67716775	missense	probably benign	0.04
R4803:Lama1	UTSW	17	67809271	missense	probably damaging	1.00
R4925:Lama1	UTSW	17	67794314	missense	probably benign	0.02
R4939:Lama1	UTSW	17	67737475	missense	possibly damaging	0.91
R4952:Lama1	UTSW	17	67767566	critical splice donor site	probably null
R4975:Lama1	UTSW	17	67738834	missense	possibly damaging	0.95
R4977:Lama1	UTSW	17	67737682	missense	probably damaging	1.00
R5039:Lama1	UTSW	17	67745893	missense	possibly damaging	0.66
R5047:Lama1	UTSW	17	67743281	nonsense	probably null
R5195:Lama1	UTSW	17	67764800	missense	probably benign	0.13
R5230:Lama1	UTSW	17	67745083	nonsense	probably null
R5236:Lama1	UTSW	17	67804492	missense	probably benign	0.24
R5254:Lama1	UTSW	17	67756716	missense	probably benign	0.01
R5345:Lama1	UTSW	17	67817563	missense	probably benign
R5438:Lama1	UTSW	17	67800774	missense	possibly damaging	0.92
R5521:Lama1	UTSW	17	67780894	nonsense	probably null
R5568:Lama1	UTSW	17	67768298	critical splice acceptor site	probably null
R5645:Lama1	UTSW	17	67802948	missense	probably damaging	1.00
R5665:Lama1	UTSW	17	67770987	missense	probably damaging	1.00
R5727:Lama1	UTSW	17	67815224	missense	possibly damaging	0.81
R5757:Lama1	UTSW	17	67738787	missense	possibly damaging	0.59
R5795:Lama1	UTSW	17	67796727	missense	probably benign	0.02
R5857:Lama1	UTSW	17	67807843	missense	probably damaging	0.99
R5894:Lama1	UTSW	17	67779047	critical splice acceptor site	probably null
R5974:Lama1	UTSW	17	67773727	missense	probably benign	0.31
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6120:Lama1	UTSW	17	67780617	critical splice donor site	probably null
R6219:Lama1	UTSW	17	67790856	missense	probably benign	0.08
R6224:Lama1	UTSW	17	67802987	missense	possibly damaging	0.56
R6249:Lama1	UTSW	17	67798604	missense	probably benign
R6265:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R6276:Lama1	UTSW	17	67784088	splice site	probably null
R6284:Lama1	UTSW	17	67810096	missense	probably damaging	0.99
R6337:Lama1	UTSW	17	67786019	missense	probably benign	0.27
R6414:Lama1	UTSW	17	67746910	critical splice donor site	probably null
R6631:Lama1	UTSW	17	67774482	missense	probably benign	0.21
R6659:Lama1	UTSW	17	67818635	missense	probably damaging	1.00
R6660:Lama1	UTSW	17	67804500	missense	probably benign	0.05
R6677:Lama1	UTSW	17	67795233	missense	probably benign	0.14
R6763:Lama1	UTSW	17	67746873	missense	unknown
R6787:Lama1	UTSW	17	67784025	missense	unknown
R6831:Lama1	UTSW	17	67756754	missense	possibly damaging	0.89
R6855:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R6910:Lama1	UTSW	17	67791464	missense	possibly damaging	0.60
R6934:Lama1	UTSW	17	67774543	missense	probably benign	0.04
R6945:Lama1	UTSW	17	67813866	missense
R6984:Lama1	UTSW	17	67779112	missense
R6989:Lama1	UTSW	17	67753758	missense
R6994:Lama1	UTSW	17	67753825	missense
R6995:Lama1	UTSW	17	67753825	missense
R7035:Lama1	UTSW	17	67781049	missense
R7133:Lama1	UTSW	17	67782146	missense
R7172:Lama1	UTSW	17	67804545	missense
R7197:Lama1	UTSW	17	67737705	nonsense	probably null
R7217:Lama1	UTSW	17	67764673	missense
R7229:Lama1	UTSW	17	67752446	missense
R7264:Lama1	UTSW	17	67743297	missense
R7311:Lama1	UTSW	17	67767385	missense
R7394:Lama1	UTSW	17	67717261	missense
R7419:Lama1	UTSW	17	67717174	missense
R7460:Lama1	UTSW	17	67767018	missense
R7492:Lama1	UTSW	17	67817651	missense
R7494:Lama1	UTSW	17	67811446	missense
R7552:Lama1	UTSW	17	67737667	missense
R7576:Lama1	UTSW	17	67782041	missense
R7583:Lama1	UTSW	17	67761621	missense
R7649:Lama1	UTSW	17	67737554	missense
R7663:Lama1	UTSW	17	67780880	missense
R7667:Lama1	UTSW	17	67780597	missense
R7688:Lama1	UTSW	17	67761628	missense
R7693:Lama1	UTSW	17	67817031	missense
R7748:Lama1	UTSW	17	67750590	missense
R7778:Lama1	UTSW	17	67804473	missense
R7824:Lama1	UTSW	17	67804473	missense
R7861:Lama1	UTSW	17	67809221	missense
R7884:Lama1	UTSW	17	67769435	missense
R7944:Lama1	UTSW	17	67809221	missense
R7967:Lama1	UTSW	17	67769435	missense
R8029:Lama1	UTSW	17	67817594	missense	not run
RF001:Lama1	UTSW	17	67752902	missense
RF013:Lama1	UTSW	17	67781062	missense
V8831:Lama1	UTSW	17	67752883	missense	probably benign	0.00
X0024:Lama1	UTSW	17	67738888	missense	probably damaging	1.00
X0028:Lama1	UTSW	17	67767422	missense	probably benign	0.00
X0028:Lama1	UTSW	17	67794310	missense	probably benign	0.06
X0066:Lama1	UTSW	17	67811566	missense	probably damaging	1.00
Z1088:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1088:Lama1	UTSW	17	67771082	missense	probably benign	0.25
Z1088:Lama1	UTSW	17	67810171	missense	probably damaging	1.00
Z1176:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1177:Lama1	UTSW	17	67752883	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGTGTGCATAAAGTCACATCTC -3'
(R):5'- TCAGCTGAAGGTGGGCATAG -3'

Sequencing Primer
(F):5'- AAAGTCACATCTCTTCTTTTTCAGG -3'
(R):5'- AAGGTGGGCATAGATAGCCTTTATC -3'

Posted On

2015-06-24