Incidental Mutation 'R4322:Hipk3'
ID 323857
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission 041093-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4322 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 104276916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 388 (V388L)
Ref Sequence ENSEMBL: ENSMUSP00000106754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably damaging
Transcript: ENSMUST00000028600
AA Change: V388L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: V388L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111124
AA Change: V388L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: V388L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111125
AA Change: V388L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: V388L

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Meta Mutation Damage Score 0.1684 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,751,701 (GRCm39) A145V probably damaging Het
Allc C A 12: 28,604,023 (GRCm39) L353F probably benign Het
Alx3 C T 3: 107,502,691 (GRCm39) P67L probably benign Het
Arhgef10l C A 4: 140,270,037 (GRCm39) G882V probably benign Het
Asb13 G T 13: 3,695,012 (GRCm39) R160L possibly damaging Het
Atxn7l2 A T 3: 108,113,148 (GRCm39) D218E probably damaging Het
Bdp1 T A 13: 100,228,731 (GRCm39) N299I probably damaging Het
Ccdc80 G T 16: 44,915,951 (GRCm39) V236L probably damaging Het
Cdhr2 A T 13: 54,881,534 (GRCm39) I1085L probably benign Het
Csn2 C T 5: 87,845,886 (GRCm39) probably null Het
Dnajb14 G A 3: 137,591,060 (GRCm39) G54S probably damaging Het
Fyb1 T A 15: 6,610,300 (GRCm39) L291Q possibly damaging Het
Ggcx A G 6: 72,405,803 (GRCm39) S545G probably benign Het
Gm12250 G A 11: 58,079,126 (GRCm39) noncoding transcript Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Kng1 A C 16: 22,898,270 (GRCm39) M557L probably benign Het
Lilrb4a T C 10: 51,367,707 (GRCm39) F83S probably damaging Het
Lmcd1 A G 6: 112,292,724 (GRCm39) E192G possibly damaging Het
Lrp2 C A 2: 69,256,335 (GRCm39) E4602* probably null Het
Mc4r T C 18: 66,992,121 (GRCm39) R331G probably benign Het
Mybpc3 A G 2: 90,954,306 (GRCm39) D393G possibly damaging Het
Or2y1f G A 11: 49,184,503 (GRCm39) M118I probably damaging Het
Or4c10b A G 2: 89,712,078 (GRCm39) K303E probably benign Het
Or5p69 C T 7: 107,967,555 (GRCm39) P286L probably damaging Het
Orc1 G A 4: 108,445,973 (GRCm39) M30I probably benign Het
Pira13 A G 7: 3,825,754 (GRCm39) S372P possibly damaging Het
Pot1a T C 6: 25,745,929 (GRCm39) T591A probably benign Het
Rnf125 G A 18: 21,110,817 (GRCm39) R25K probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sh3rf2 A T 18: 42,244,464 (GRCm39) H310L probably damaging Het
Shld2 G T 14: 33,981,632 (GRCm39) T502K probably damaging Het
Srgap1 T C 10: 121,705,711 (GRCm39) K238E probably damaging Het
Ssc5d C T 7: 4,931,449 (GRCm39) R219C probably damaging Het
Them5 C A 3: 94,253,463 (GRCm39) H158N probably damaging Het
Vmn1r203 A T 13: 22,708,408 (GRCm39) N63I probably damaging Het
Vps41 T A 13: 19,007,960 (GRCm39) F264L probably damaging Het
Vtn A T 11: 78,390,916 (GRCm39) probably benign Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0277:Hipk3 UTSW 2 104,271,593 (GRCm39) missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4604:Hipk3 UTSW 2 104,269,674 (GRCm39) missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104,268,242 (GRCm39) missense probably benign 0.21
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9187:Hipk3 UTSW 2 104,276,936 (GRCm39) missense probably damaging 1.00
R9374:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9584:Hipk3 UTSW 2 104,301,910 (GRCm39) missense probably benign 0.01
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGACATTCATGGAGATTTTC -3'
(R):5'- TGACCGAGGGTTAGGATCG -3'

Sequencing Primer
(F):5'- CACATTTTGTGTATGGAGAATCATGC -3'
(R):5'- GTTTGACAAGTTCTCAGCGAC -3'
Posted On 2015-06-24