Incidental Mutation 'R4322:Dnajb14'
ID323863
Institutional Source Beutler Lab
Gene Symbol Dnajb14
Ensembl Gene ENSMUSG00000074212
Gene NameDnaJ heat shock protein family (Hsp40) member B14
Synonyms
MMRRC Submission 041093-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R4322 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location137867675-137916557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137885299 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 54 (G54S)
Ref Sequence ENSEMBL: ENSMUSP00000087641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090178] [ENSMUST00000197711]
Predicted Effect probably damaging
Transcript: ENSMUST00000090178
AA Change: G54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087641
Gene: ENSMUSG00000074212
AA Change: G54S

DomainStartEndE-ValueType
DnaJ 107 164 3.8e-28 SMART
low complexity region 226 242 N/A INTRINSIC
Pfam:DUF1977 265 371 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125226
Predicted Effect probably damaging
Transcript: ENSMUST00000197711
AA Change: G4S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143194
Gene: ENSMUSG00000074212
AA Change: G4S

DomainStartEndE-ValueType
DnaJ 57 114 2.4e-30 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,667,244 A145V probably damaging Het
Allc C A 12: 28,554,024 L353F probably benign Het
Alx3 C T 3: 107,595,375 P67L probably benign Het
Arhgef10l C A 4: 140,542,726 G882V probably benign Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bdp1 T A 13: 100,092,223 N299I probably damaging Het
Ccdc80 G T 16: 45,095,588 V236L probably damaging Het
Cdhr2 A T 13: 54,733,721 I1085L probably benign Het
Csn2 C T 5: 87,698,027 probably null Het
Fam35a G T 14: 34,259,675 T502K probably damaging Het
Fyb T A 15: 6,580,819 L291Q possibly damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm12250 G A 11: 58,188,300 noncoding transcript Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kng1 A C 16: 23,079,520 M557L probably benign Het
Lilrb4a T C 10: 51,491,611 F83S probably damaging Het
Lmcd1 A G 6: 112,315,763 E192G possibly damaging Het
Lrp2 C A 2: 69,425,991 E4602* probably null Het
Mc4r T C 18: 66,859,050 R331G probably benign Het
Mybpc3 A G 2: 91,123,961 D393G possibly damaging Het
Olfr1257 A G 2: 89,881,734 K303E probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr494 C T 7: 108,368,348 P286L probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pot1a T C 6: 25,745,930 T591A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3rf2 A T 18: 42,111,399 H310L probably damaging Het
Srgap1 T C 10: 121,869,806 K238E probably damaging Het
Ssc5d C T 7: 4,928,450 R219C probably damaging Het
Them5 C A 3: 94,346,156 H158N probably damaging Het
Vmn1r203 A T 13: 22,524,238 N63I probably damaging Het
Vps41 T A 13: 18,823,790 F264L probably damaging Het
Vtn A T 11: 78,500,090 probably benign Het
Other mutations in Dnajb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Dnajb14 APN 3 137906000 missense possibly damaging 0.95
R1104:Dnajb14 UTSW 3 137908354 missense possibly damaging 0.75
R2271:Dnajb14 UTSW 3 137885380 missense probably benign
R2425:Dnajb14 UTSW 3 137892905 missense probably null 1.00
R3418:Dnajb14 UTSW 3 137892870 missense probably null 0.99
R3921:Dnajb14 UTSW 3 137904852 missense probably damaging 1.00
R5378:Dnajb14 UTSW 3 137885378 missense probably benign 0.01
R6256:Dnajb14 UTSW 3 137908362 missense probably damaging 1.00
R6256:Dnajb14 UTSW 3 137908363 missense probably damaging 1.00
R7577:Dnajb14 UTSW 3 137904797 missense possibly damaging 0.84
X0028:Dnajb14 UTSW 3 137902302 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CAGCTCTGACAAGCAACCTG -3'
(R):5'- AGTCAACGATCATGGTGCGG -3'

Sequencing Primer
(F):5'- CCCAACTGCATGGTAAGGTCATG -3'
(R):5'- TGCGGACACACTCGCATTC -3'
Posted On2015-06-24