Incidental Mutation 'R4322:Pot1a'
ID 323868
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission 041093-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4322 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25745930 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 591 (T591A)
Ref Sequence ENSEMBL: ENSMUSP00000131928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115329
SMART Domains Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115330
AA Change: T591A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: T591A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134339
Predicted Effect probably benign
Transcript: ENSMUST00000166445
AA Change: T591A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: T591A

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,667,244 A145V probably damaging Het
Allc C A 12: 28,554,024 L353F probably benign Het
Alx3 C T 3: 107,595,375 P67L probably benign Het
Arhgef10l C A 4: 140,542,726 G882V probably benign Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bdp1 T A 13: 100,092,223 N299I probably damaging Het
Ccdc80 G T 16: 45,095,588 V236L probably damaging Het
Cdhr2 A T 13: 54,733,721 I1085L probably benign Het
Csn2 C T 5: 87,698,027 probably null Het
Dnajb14 G A 3: 137,885,299 G54S probably damaging Het
Fam35a G T 14: 34,259,675 T502K probably damaging Het
Fyb T A 15: 6,580,819 L291Q possibly damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm12250 G A 11: 58,188,300 noncoding transcript Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kng1 A C 16: 23,079,520 M557L probably benign Het
Lilrb4a T C 10: 51,491,611 F83S probably damaging Het
Lmcd1 A G 6: 112,315,763 E192G possibly damaging Het
Lrp2 C A 2: 69,425,991 E4602* probably null Het
Mc4r T C 18: 66,859,050 R331G probably benign Het
Mybpc3 A G 2: 91,123,961 D393G possibly damaging Het
Olfr1257 A G 2: 89,881,734 K303E probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr494 C T 7: 108,368,348 P286L probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3rf2 A T 18: 42,111,399 H310L probably damaging Het
Srgap1 T C 10: 121,869,806 K238E probably damaging Het
Ssc5d C T 7: 4,928,450 R219C probably damaging Het
Them5 C A 3: 94,346,156 H158N probably damaging Het
Vmn1r203 A T 13: 22,524,238 N63I probably damaging Het
Vps41 T A 13: 18,823,790 F264L probably damaging Het
Vtn A T 11: 78,500,090 probably benign Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8078:Pot1a UTSW 6 25750108 missense probably benign 0.13
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
R9070:Pot1a UTSW 6 25744630 missense
Predicted Primers PCR Primer
(F):5'- GCTACAGATTTGAAACATGCTAGG -3'
(R):5'- TTGAAATTCCGTGCATTGAAGC -3'

Sequencing Primer
(F):5'- TTCTAAGAAAACAGAGAGAGAGAGAG -3'
(R):5'- AATCTAGCCTGAGTCCTCTGCTAAG -3'
Posted On 2015-06-24