Incidental Mutation 'R0004:Tgfb1'
ID32387
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Nametransforming growth factor, beta 1
SynonymsTgfb, TGF-beta 1, TGFbeta1, Tgfb-1, TGF-beta1
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location25687002-25705077 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 25692366 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000169009]
Predicted Effect probably benign
Transcript: ENSMUST00000002678
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206584
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25688017 missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25704196 missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25696918 missense probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0470:Tgfb1 UTSW 7 25687930 unclassified probably benign
R1872:Tgfb1 UTSW 7 25692466 missense probably damaging 1.00
R2178:Tgfb1 UTSW 7 25704809 missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25697230 missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25688149 missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25694281 missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25696960 missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25696925 missense probably benign 0.01
R6727:Tgfb1 UTSW 7 25689162 unclassified probably benign
R7203:Tgfb1 UTSW 7 25692539 critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25704838 missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25687695 unclassified probably benign
Z1177:Tgfb1 UTSW 7 25688208 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTGAGGTCAGCCAGTTAAGAAC -3'
(R):5'- TACCCAGGAGCCTTCAAACTGAGC -3'

Sequencing Primer
(F):5'- ccctcttctggcttccac -3'
(R):5'- AAAGCCTTACCTGGTAGAGTTCC -3'
Posted On2013-05-09