Mutagenetix > Incidental Mutations

Incidental Mutation 'R4322:Srgap1'

323877

Institutional Source

Beutler Lab

Gene Symbol

Srgap1

Ensembl Gene

ENSMUSG00000020121

Gene Name

SLIT-ROBO Rho GTPase activating protein 1

Synonyms

Arhgap13, 4930572H05Rik

MMRRC Submission

041093-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.273) question?

Stock #

R4322 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121780991-122047315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121869806 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 238 (K238E)

Ref Sequence

ENSEMBL: ENSMUSP00000080389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020322
AA Change: K238E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: K238E

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	494	668	1.27e-64	SMART
SH3	723	778	1.57e-14	SMART
low complexity region	826	840	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081688
AA Change: K238E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: K238E

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	517	691	1.27e-64	SMART
SH3	746	801	1.57e-14	SMART
low complexity region	849	863	N/A	INTRINSIC
low complexity region	1027	1037	N/A	INTRINSIC

Meta Mutation Damage Score

0.1447

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

94% (48/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actrt2	G	A	4: 154,667,244	A145V	probably damaging	Het
Allc	C	A	12: 28,554,024	L353F	probably benign	Het
Alx3	C	T	3: 107,595,375	P67L	probably benign	Het
Arhgef10l	C	A	4: 140,542,726	G882V	probably benign	Het
Asb13	G	T	13: 3,645,012	R160L	possibly damaging	Het
Atxn7l2	A	T	3: 108,205,832	D218E	probably damaging	Het
Bdp1	T	A	13: 100,092,223	N299I	probably damaging	Het
Ccdc80	G	T	16: 45,095,588	V236L	probably damaging	Het
Cdhr2	A	T	13: 54,733,721	I1085L	probably benign	Het
Csn2	C	T	5: 87,698,027		probably null	Het
Dnajb14	G	A	3: 137,885,299	G54S	probably damaging	Het
Fam35a	G	T	14: 34,259,675	T502K	probably damaging	Het
Fyb	T	A	15: 6,580,819	L291Q	possibly damaging	Het
Ggcx	A	G	6: 72,428,820	S545G	probably benign	Het
Gm12250	G	A	11: 58,188,300		noncoding transcript	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Hipk3	C	A	2: 104,446,571	V388L	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Kng1	A	C	16: 23,079,520	M557L	probably benign	Het
Lilrb4a	T	C	10: 51,491,611	F83S	probably damaging	Het
Lmcd1	A	G	6: 112,315,763	E192G	possibly damaging	Het
Lrp2	C	A	2: 69,425,991	E4602*	probably null	Het
Mc4r	T	C	18: 66,859,050	R331G	probably benign	Het
Mybpc3	A	G	2: 91,123,961	D393G	possibly damaging	Het
Olfr1257	A	G	2: 89,881,734	K303E	probably benign	Het
Olfr1392	G	A	11: 49,293,676	M118I	probably damaging	Het
Olfr494	C	T	7: 108,368,348	P286L	probably damaging	Het
Orc1	G	A	4: 108,588,776	M30I	probably benign	Het
Pot1a	T	C	6: 25,745,930	T591A	probably benign	Het
Rnf125	G	A	18: 20,977,760	R25K	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sh3rf2	A	T	18: 42,111,399	H310L	probably damaging	Het
Ssc5d	C	T	7: 4,928,450	R219C	probably damaging	Het
Them5	C	A	3: 94,346,156	H158N	probably damaging	Het
Vmn1r203	A	T	13: 22,524,238	N63I	probably damaging	Het
Vps41	T	A	13: 18,823,790	F264L	probably damaging	Het
Vtn	A	T	11: 78,500,090		probably benign	Het

Other mutations in Srgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01964:Srgap1	APN	10	121804966	missense	possibly damaging	0.81
IGL02106:Srgap1	APN	10	121785693	missense	possibly damaging	0.95
IGL02927:Srgap1	APN	10	121855462	missense	probably damaging	0.99
IGL03088:Srgap1	APN	10	121825693	missense	possibly damaging	0.94
IGL03208:Srgap1	APN	10	121792266	missense	possibly damaging	0.89
IGL03251:Srgap1	APN	10	121804921	splice site	probably null
PIT1430001:Srgap1	UTSW	10	121896753	splice site	probably benign
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0356:Srgap1	UTSW	10	121855536	splice site	probably null
R0361:Srgap1	UTSW	10	122047192	start codon destroyed	probably null	0.89
R0365:Srgap1	UTSW	10	121785705	missense	possibly damaging	0.80
R0675:Srgap1	UTSW	10	121792235	missense	probably damaging	1.00
R0801:Srgap1	UTSW	10	121807875	missense	probably damaging	0.96
R0815:Srgap1	UTSW	10	121785474	missense	probably damaging	0.99
R1034:Srgap1	UTSW	10	121785445	missense	possibly damaging	0.69
R1160:Srgap1	UTSW	10	121855477	missense	probably benign	0.01
R1454:Srgap1	UTSW	10	121896738	missense	probably damaging	0.99
R1624:Srgap1	UTSW	10	121855373	missense	probably benign	0.03
R1628:Srgap1	UTSW	10	121870339	missense	probably benign	0.15
R1816:Srgap1	UTSW	10	121925971	nonsense	probably null
R1933:Srgap1	UTSW	10	121925903	missense	possibly damaging	0.89
R2034:Srgap1	UTSW	10	121792746	missense	probably damaging	0.98
R2211:Srgap1	UTSW	10	121853740	missense	possibly damaging	0.55
R2295:Srgap1	UTSW	10	121794760	missense	probably benign	0.03
R2368:Srgap1	UTSW	10	121829289	missense	probably benign	0.05
R3796:Srgap1	UTSW	10	122047132	missense	probably benign	0.06
R4083:Srgap1	UTSW	10	121785690	missense	probably damaging	1.00
R4172:Srgap1	UTSW	10	121855363	missense	probably benign	0.00
R4401:Srgap1	UTSW	10	121804921	splice site	probably null
R4513:Srgap1	UTSW	10	121870326	critical splice donor site	probably null
R4698:Srgap1	UTSW	10	121792487	missense	probably benign	0.22
R4776:Srgap1	UTSW	10	121792351	missense	probably benign	0.03
R4951:Srgap1	UTSW	10	121785552	missense	probably benign	0.20
R5116:Srgap1	UTSW	10	121792379	missense	possibly damaging	0.77
R5232:Srgap1	UTSW	10	121840911	missense	probably benign	0.00
R5237:Srgap1	UTSW	10	121807883	missense	probably damaging	1.00
R5335:Srgap1	UTSW	10	121785377	utr 3 prime	probably benign
R5402:Srgap1	UTSW	10	121785760	missense	probably benign	0.06
R5432:Srgap1	UTSW	10	121869823	missense	probably damaging	1.00
R5456:Srgap1	UTSW	10	121869811	missense	probably benign	0.45
R5669:Srgap1	UTSW	10	121804850	missense	probably benign	0.00
R5682:Srgap1	UTSW	10	121805014	missense	probably damaging	1.00
R5687:Srgap1	UTSW	10	121825636	missense	probably damaging	1.00
R5773:Srgap1	UTSW	10	121896709	missense	probably benign	0.02
R5832:Srgap1	UTSW	10	121840914	missense	probably damaging	1.00
R6028:Srgap1	UTSW	10	121828730	missense	probably null
R6240:Srgap1	UTSW	10	122047156	missense	probably benign	0.06
R6336:Srgap1	UTSW	10	121925941	missense	probably benign	0.01
R6435:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R6597:Srgap1	UTSW	10	121792371	missense	probably benign	0.11
R6798:Srgap1	UTSW	10	121925904	missense	probably damaging	1.00
R6807:Srgap1	UTSW	10	121828726	splice site	probably null
R6897:Srgap1	UTSW	10	121785618	missense	probably damaging	0.96
R7057:Srgap1	UTSW	10	121804953	missense	probably benign	0.20
R7196:Srgap1	UTSW	10	121840848	missense	probably benign	0.00
R7247:Srgap1	UTSW	10	121869790	missense	probably damaging	0.98
R7404:Srgap1	UTSW	10	121785745	missense	probably benign	0.18
R7467:Srgap1	UTSW	10	121855439	nonsense	probably null
R7792:Srgap1	UTSW	10	121925967	missense	probably damaging	0.98
R7846:Srgap1	UTSW	10	121785492	missense	probably damaging	0.97
R7896:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R7912:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R8127:Srgap1	UTSW	10	121855366	missense	probably null	0.04
R8233:Srgap1	UTSW	10	121825436	missense	probably damaging	1.00
R8248:Srgap1	UTSW	10	121804817	missense	probably damaging	0.99
R8362:Srgap1	UTSW	10	121855478	missense	possibly damaging	0.46
X0063:Srgap1	UTSW	10	121785412	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGAGCGACTCCAACGAATG -3'
(R):5'- TTTTCAGAGCCAGGGAACTTG -3'

Sequencing Primer
(F):5'- AACGAATGCTGGCACTTTCC -3'
(R):5'- CGTCGAGATGACTTTGCT -3'

Posted On

2015-06-24