Incidental Mutation 'R4322:Asb13'
ID323882
Institutional Source Beutler Lab
Gene Symbol Asb13
Ensembl Gene ENSMUSG00000033781
Gene Nameankyrin repeat and SOCS box-containing 13
Synonyms6430573K02Rik, 2210015B19Rik
MMRRC Submission 041093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4322 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3634032-3653822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3645012 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 160 (R160L)
Ref Sequence ENSEMBL: ENSMUSP00000046476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042288
AA Change: R160L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046476
Gene: ENSMUSG00000033781
AA Change: R160L

DomainStartEndE-ValueType
ANK 18 47 1.25e2 SMART
ANK 51 80 3.91e-3 SMART
ANK 84 113 1.53e-5 SMART
ANK 116 145 3.71e-4 SMART
ANK 149 178 6.65e-6 SMART
ANK 181 210 6.92e-4 SMART
SOCS_box 239 278 2.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157850
Meta Mutation Damage Score 0.1097 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,667,244 A145V probably damaging Het
Allc C A 12: 28,554,024 L353F probably benign Het
Alx3 C T 3: 107,595,375 P67L probably benign Het
Arhgef10l C A 4: 140,542,726 G882V probably benign Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bdp1 T A 13: 100,092,223 N299I probably damaging Het
Ccdc80 G T 16: 45,095,588 V236L probably damaging Het
Cdhr2 A T 13: 54,733,721 I1085L probably benign Het
Csn2 C T 5: 87,698,027 probably null Het
Dnajb14 G A 3: 137,885,299 G54S probably damaging Het
Fam35a G T 14: 34,259,675 T502K probably damaging Het
Fyb T A 15: 6,580,819 L291Q possibly damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm12250 G A 11: 58,188,300 noncoding transcript Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kng1 A C 16: 23,079,520 M557L probably benign Het
Lilrb4a T C 10: 51,491,611 F83S probably damaging Het
Lmcd1 A G 6: 112,315,763 E192G possibly damaging Het
Lrp2 C A 2: 69,425,991 E4602* probably null Het
Mc4r T C 18: 66,859,050 R331G probably benign Het
Mybpc3 A G 2: 91,123,961 D393G possibly damaging Het
Olfr1257 A G 2: 89,881,734 K303E probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr494 C T 7: 108,368,348 P286L probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pot1a T C 6: 25,745,930 T591A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3rf2 A T 18: 42,111,399 H310L probably damaging Het
Srgap1 T C 10: 121,869,806 K238E probably damaging Het
Ssc5d C T 7: 4,928,450 R219C probably damaging Het
Them5 C A 3: 94,346,156 H158N probably damaging Het
Vmn1r203 A T 13: 22,524,238 N63I probably damaging Het
Vps41 T A 13: 18,823,790 F264L probably damaging Het
Vtn A T 11: 78,500,090 probably benign Het
Other mutations in Asb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Asb13 APN 13 3643476 missense probably null 1.00
IGL00929:Asb13 APN 13 3649427 missense probably damaging 1.00
IGL01533:Asb13 APN 13 3642164 missense probably benign 0.05
R0654:Asb13 UTSW 13 3642092 missense probably damaging 1.00
R0694:Asb13 UTSW 13 3649480 missense probably benign 0.16
R0883:Asb13 UTSW 13 3645052 critical splice donor site probably null
R2014:Asb13 UTSW 13 3649512 critical splice donor site probably null
R2290:Asb13 UTSW 13 3649418 missense probably damaging 1.00
R4320:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4324:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4895:Asb13 UTSW 13 3643589 missense probably damaging 0.99
R5305:Asb13 UTSW 13 3643479 missense probably damaging 1.00
R6417:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6420:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6813:Asb13 UTSW 13 3645029 missense probably damaging 1.00
R7648:Asb13 UTSW 13 3649332 missense probably damaging 1.00
R7735:Asb13 UTSW 13 3634180 splice site probably null
R7771:Asb13 UTSW 13 3649463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTTCATCATGGCTACC -3'
(R):5'- GACGAACTGAGAAATGCTGTC -3'

Sequencing Primer
(F):5'- ATGGCTACCATTTCCAGTGTG -3'
(R):5'- TTTCCAGTTTCATAGACACAGAGGCC -3'
Posted On2015-06-24