Incidental Mutation 'R4322:Vps41'
ID323883
Institutional Source Beutler Lab
Gene Symbol Vps41
Ensembl Gene ENSMUSG00000041236
Gene NameVPS41 HOPS complex subunit
SynonymsVam2, mVam2
MMRRC Submission 041093-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4322 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location18717286-18866811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18823790 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 264 (F264L)
Ref Sequence ENSEMBL: ENSMUSP00000072729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072961]
Predicted Effect probably damaging
Transcript: ENSMUST00000072961
AA Change: F264L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236
AA Change: F264L

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Blast:WD40 34 70 2e-7 BLAST
SCOP:d1flga_ 44 253 6e-9 SMART
Blast:WD40 159 195 3e-11 BLAST
CLH 570 711 1.92e-42 SMART
RING 790 837 8.98e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222813
Meta Mutation Damage Score 0.5652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,667,244 A145V probably damaging Het
Allc C A 12: 28,554,024 L353F probably benign Het
Alx3 C T 3: 107,595,375 P67L probably benign Het
Arhgef10l C A 4: 140,542,726 G882V probably benign Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bdp1 T A 13: 100,092,223 N299I probably damaging Het
Ccdc80 G T 16: 45,095,588 V236L probably damaging Het
Cdhr2 A T 13: 54,733,721 I1085L probably benign Het
Csn2 C T 5: 87,698,027 probably null Het
Dnajb14 G A 3: 137,885,299 G54S probably damaging Het
Fam35a G T 14: 34,259,675 T502K probably damaging Het
Fyb T A 15: 6,580,819 L291Q possibly damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm12250 G A 11: 58,188,300 noncoding transcript Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kng1 A C 16: 23,079,520 M557L probably benign Het
Lilrb4a T C 10: 51,491,611 F83S probably damaging Het
Lmcd1 A G 6: 112,315,763 E192G possibly damaging Het
Lrp2 C A 2: 69,425,991 E4602* probably null Het
Mc4r T C 18: 66,859,050 R331G probably benign Het
Mybpc3 A G 2: 91,123,961 D393G possibly damaging Het
Olfr1257 A G 2: 89,881,734 K303E probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr494 C T 7: 108,368,348 P286L probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pot1a T C 6: 25,745,930 T591A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3rf2 A T 18: 42,111,399 H310L probably damaging Het
Srgap1 T C 10: 121,869,806 K238E probably damaging Het
Ssc5d C T 7: 4,928,450 R219C probably damaging Het
Them5 C A 3: 94,346,156 H158N probably damaging Het
Vmn1r203 A T 13: 22,524,238 N63I probably damaging Het
Vtn A T 11: 78,500,090 probably benign Het
Other mutations in Vps41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Vps41 APN 13 18866150 missense probably benign 0.37
IGL01563:Vps41 APN 13 18782727 splice site probably benign
IGL01880:Vps41 APN 13 18810471 missense probably benign 0.01
IGL02024:Vps41 APN 13 18791657 splice site probably benign
IGL02458:Vps41 APN 13 18853479 missense possibly damaging 0.67
IGL02740:Vps41 APN 13 18838680 missense probably damaging 1.00
IGL03218:Vps41 APN 13 18829270 missense possibly damaging 0.74
R0197:Vps41 UTSW 13 18854663 critical splice donor site probably null
R0284:Vps41 UTSW 13 18853440 missense probably damaging 1.00
R0321:Vps41 UTSW 13 18842295 splice site probably benign
R0372:Vps41 UTSW 13 18842247 missense probably benign 0.00
R0382:Vps41 UTSW 13 18827727 missense probably benign 0.30
R1691:Vps41 UTSW 13 18841243 missense probably damaging 1.00
R2055:Vps41 UTSW 13 18854616 missense possibly damaging 0.95
R2082:Vps41 UTSW 13 18852351 missense probably benign 0.27
R2147:Vps41 UTSW 13 18839734 splice site probably null
R2897:Vps41 UTSW 13 18810428 splice site probably benign
R4600:Vps41 UTSW 13 18745283 missense probably damaging 0.97
R4751:Vps41 UTSW 13 18811622 missense probably damaging 0.98
R4856:Vps41 UTSW 13 18829255 missense probably damaging 0.98
R5389:Vps41 UTSW 13 18862538 missense probably damaging 0.99
R7022:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R7456:Vps41 UTSW 13 18864034 missense probably benign 0.02
R7747:Vps41 UTSW 13 18841252 critical splice donor site probably null
R7790:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R8029:Vps41 UTSW 13 18823785 nonsense probably null
R8033:Vps41 UTSW 13 18810465 missense possibly damaging 0.94
Z1177:Vps41 UTSW 13 18845935 missense probably benign 0.00
Z1177:Vps41 UTSW 13 18854595 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGCATGGTGAAAGTACTTTAAC -3'
(R):5'- TAGCAATCTCCCCTGACAGG -3'

Sequencing Primer
(F):5'- TGAGACACACTACAGCGCATATTTAG -3'
(R):5'- TCCCCTGACAGGCAGCC -3'
Posted On2015-06-24