Incidental Mutation 'R4322:Vmn1r203'
ID323884
Institutional Source Beutler Lab
Gene Symbol Vmn1r203
Ensembl Gene ENSMUSG00000069289
Gene Namevomeronasal 1 receptor 203
SynonymsV1rh11
MMRRC Submission 041093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4322 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22518114-22531992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22524238 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 63 (N63I)
Ref Sequence ENSEMBL: ENSMUSP00000154399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091729] [ENSMUST00000227520] [ENSMUST00000228889]
Predicted Effect probably damaging
Transcript: ENSMUST00000091729
AA Change: N63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089322
Gene: ENSMUSG00000069289
AA Change: N63I

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
Pfam:V1R 43 304 5.8e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137651
Predicted Effect probably damaging
Transcript: ENSMUST00000227520
AA Change: N63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228889
AA Change: N63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,667,244 A145V probably damaging Het
Allc C A 12: 28,554,024 L353F probably benign Het
Alx3 C T 3: 107,595,375 P67L probably benign Het
Arhgef10l C A 4: 140,542,726 G882V probably benign Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bdp1 T A 13: 100,092,223 N299I probably damaging Het
Ccdc80 G T 16: 45,095,588 V236L probably damaging Het
Cdhr2 A T 13: 54,733,721 I1085L probably benign Het
Csn2 C T 5: 87,698,027 probably null Het
Dnajb14 G A 3: 137,885,299 G54S probably damaging Het
Fam35a G T 14: 34,259,675 T502K probably damaging Het
Fyb T A 15: 6,580,819 L291Q possibly damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm12250 G A 11: 58,188,300 noncoding transcript Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kng1 A C 16: 23,079,520 M557L probably benign Het
Lilrb4a T C 10: 51,491,611 F83S probably damaging Het
Lmcd1 A G 6: 112,315,763 E192G possibly damaging Het
Lrp2 C A 2: 69,425,991 E4602* probably null Het
Mc4r T C 18: 66,859,050 R331G probably benign Het
Mybpc3 A G 2: 91,123,961 D393G possibly damaging Het
Olfr1257 A G 2: 89,881,734 K303E probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr494 C T 7: 108,368,348 P286L probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pot1a T C 6: 25,745,930 T591A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3rf2 A T 18: 42,111,399 H310L probably damaging Het
Srgap1 T C 10: 121,869,806 K238E probably damaging Het
Ssc5d C T 7: 4,928,450 R219C probably damaging Het
Them5 C A 3: 94,346,156 H158N probably damaging Het
Vps41 T A 13: 18,823,790 F264L probably damaging Het
Vtn A T 11: 78,500,090 probably benign Het
Other mutations in Vmn1r203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Vmn1r203 APN 13 22524777 missense probably damaging 1.00
IGL01527:Vmn1r203 APN 13 22524277 missense possibly damaging 0.89
IGL01808:Vmn1r203 APN 13 22524547 missense probably benign 0.02
IGL01887:Vmn1r203 APN 13 22524876 missense probably benign 0.00
IGL02340:Vmn1r203 APN 13 22524827 nonsense probably null
IGL02543:Vmn1r203 APN 13 22524904 missense probably damaging 1.00
IGL02684:Vmn1r203 APN 13 22524369 missense possibly damaging 0.95
BB005:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
BB015:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
PIT4519001:Vmn1r203 UTSW 13 22524595 missense probably benign 0.01
R0544:Vmn1r203 UTSW 13 22524273 missense possibly damaging 0.94
R1365:Vmn1r203 UTSW 13 22524586 missense probably benign 0.00
R1396:Vmn1r203 UTSW 13 22524508 missense probably benign 0.01
R1794:Vmn1r203 UTSW 13 22524351 missense probably damaging 1.00
R2010:Vmn1r203 UTSW 13 22524447 missense possibly damaging 0.56
R2169:Vmn1r203 UTSW 13 22524735 nonsense probably null
R2333:Vmn1r203 UTSW 13 22524943 missense probably damaging 1.00
R2418:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R2419:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R4460:Vmn1r203 UTSW 13 22524682 missense probably damaging 0.98
R4686:Vmn1r203 UTSW 13 22524358 missense probably damaging 1.00
R5526:Vmn1r203 UTSW 13 22524103 missense probably benign 0.01
R6240:Vmn1r203 UTSW 13 22524729 missense possibly damaging 0.89
R6607:Vmn1r203 UTSW 13 22524721 missense probably benign 0.23
R7575:Vmn1r203 UTSW 13 22524418 missense probably benign 0.12
R7928:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
R8375:Vmn1r203 UTSW 13 22524984 makesense probably null
Z1177:Vmn1r203 UTSW 13 22524409 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCTACAATTGAAGAGGTTTCCTTCC -3'
(R):5'- ATGATGATGGCCTGGACCAC -3'

Sequencing Primer
(F):5'- GAAGAGGTTTCCTTCCAAAAGTG -3'
(R):5'- TGGCCTGGACCACAGTAAG -3'
Posted On2015-06-24