Mutagenetix > Incidental Mutation

Incidental Mutation 'R4323:Fap'

323902

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

041094-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4323 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62503372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 643 (H643R)

Ref Sequence

ENSEMBL: ENSMUSP00000000402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000128139] [ENSMUST00000174234] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably damaging
Transcript: ENSMUST00000000402
AA Change: H643R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: H643R

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102732
AA Change: H676R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: H676R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128139
AA Change: H18R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152085

Predicted Effect

probably benign
Transcript: ENSMUST00000174234
AA Change: H651R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: H651R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174448
AA Change: H671R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: H671R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Meta Mutation Damage Score

0.0774

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	G	4: 62,547,311	Y414C	probably damaging	Het
Akr1b3	T	C	6: 34,310,927	T166A	probably benign	Het
Ankhd1	C	T	18: 36,578,633	S94L	probably damaging	Het
B4galt3	G	T	1: 171,275,942	M68I	possibly damaging	Het
Bpnt1	A	C	1: 185,356,589	H312P	probably benign	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Ccdc191	A	G	16: 43,947,509	E624G	probably damaging	Het
Clasp2	T	C	9: 113,889,959	V724A	possibly damaging	Het
Copa	G	T	1: 172,119,264	C1022F	probably damaging	Het
Cwf19l2	T	G	9: 3,430,452	F261L	probably damaging	Het
Esr1	G	A	10: 5,001,307	V562M	possibly damaging	Het
Fbxo38	T	A	18: 62,515,161	M769L	probably benign	Het
Fgfr1	A	G	8: 25,573,899	N814S	probably benign	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Hipk3	C	A	2: 104,446,571	V388L	probably damaging	Het
Hspa1l	T	A	17: 34,977,856	Y290*	probably null	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Jam2	T	C	16: 84,822,856		probably benign	Het
Kprp	G	A	3: 92,824,856	R296W	probably damaging	Het
Med23	T	C	10: 24,870,705	I14T	probably benign	Het
Mitf	A	G	6: 97,991,949	Y10C	probably benign	Het
Mpo	T	C	11: 87,796,039	S165P	probably damaging	Het
Neb	T	G	2: 52,264,110	M2330L	possibly damaging	Het
Nup214	T	C	2: 31,994,684	S486P	probably benign	Het
Olfr1392	G	A	11: 49,293,676	M118I	probably damaging	Het
Parp6	G	A	9: 59,630,686	V205I	possibly damaging	Het
Pate2	A	T	9: 35,670,471		probably benign	Het
Pdss1	T	C	2: 22,912,596		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sept1	G	A	7: 127,217,028	P77S	probably damaging	Het
Slitrk3	A	G	3: 73,050,785	L218P	probably damaging	Het
Sltm	T	C	9: 70,580,247	I521T	probably benign	Het
Smchd1	A	G	17: 71,428,275	I618T	probably benign	Het
Sox6	A	G	7: 115,580,563		probably null	Het
Sp8	A	G	12: 118,848,436	I9V	probably benign	Het
Usp9y	T	A	Y: 1,434,407	M352L	possibly damaging	Het
Vmn1r46	T	C	6: 89,976,367	M66T	probably benign	Het
Vmn2r111	A	T	17: 22,573,178	N32K	probably benign	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Vps13d	T	A	4: 145,152,778	T1486S	probably benign	Het
Wdr55	A	G	18: 36,763,100	N281S	probably benign	Het
Zswim6	G	A	13: 107,889,403		noncoding transcript	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R0842:Fap	UTSW	2	62537001	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3546:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3801:Fap	UTSW	2	62546650	missense	probably benign	0.04
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5281:Fap	UTSW	2	62532961	critical splice donor site	probably null
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6270:Fap	UTSW	2	62547788	missense	probably damaging	0.98
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8000:Fap	UTSW	2	62502798	critical splice donor site	probably null
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
R9521:Fap	UTSW	2	62542156	missense	probably benign
R9686:Fap	UTSW	2	62573513	missense	possibly damaging	0.86
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCCGCTCAAGCTGTGTAG -3'
(R):5'- TACCTCAGAGTCTTCCCACG -3'

Sequencing Primer
(F):5'- CTCAAGCTGTGTAGGCGTTG -3'
(R):5'- AGAGTCTTCCCACGGGAGAAC -3'

Posted On

2015-06-24